FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_27_JM72_CCGTCC_L002_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_27_JM72_CCGTCC_L002_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2931890
Sequences flagged as poor quality0
Sequence length1-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG30142210.280808625153059No Hit
TTCAAGTAATCCAGGATAGGCT2099087.15947733373353No Hit
AACATTCAACGCTGTCGGTGAGT1677305.720883116351568No Hit
TGAGGTAGTAGGTTGTATAGTT1228734.190914393104789No Hit
TAAAGCTAGAGAACCGAAAGTA608072.073986404674118No Hit
TCACAGTGAACCGGTCTCTTT602652.055500035813076No Hit
AACATTCAACGCTGTCGGTGA595462.030976605534314No Hit
TCCCTGAGACCCTTAACCTGT565271.9280054845168135No Hit
AACCCGTAGATCCGAACTTGTG516141.760434395560543No Hit
TCCCTGAGACCCTTAACCTGTG415701.4178567408736344No Hit
TATTGCACTCGTCCCGGCCTCC407371.389445033749561No Hit
TAAAGCTAGAGAACCGAAAGT323771.1043047317600592No Hit
AGCTACATCTGGCTACTGGGTCTC308701.0529044404803727No Hit
TCCAGCATCAGTGATTTTGTT275140.9384390273850657No Hit
TGAGGTAGTAGTTTGTATAGTT257070.8768064286177176No Hit
TCTTTGGTTATCTAGCTGTATGA256030.8732592286886616No Hit
TCCCTGAGACCCTTAACCTGTGA241660.8242464758227628No Hit
TGAGGTAGTAGGTTGTATAGT232930.7944704610336677No Hit
TGAGGTAGTAGTTTGTGCTGTT232890.7943340302671655No Hit
AACATTCATTGCTGTCGGTGGG210170.7168413548939421No Hit
TCCCTGAGACCCTAACTTGTGA205980.7025502321028415No Hit
TCTTTGGTTATCTAGCTGTAT204430.6972635399008831No Hit
TTAAAGGGAATTTGCGACTGTT188680.6435439255906599No Hit
TAGCTTATCAGACTGGTGTTGGC186830.6372340026399353No Hit
ACCTTGGCTTTAGACTGCTTACT166460.5677566347987135No Hit
CCACGTTCCCGTGG158130.5393449276746399No Hit
AACCCGTAGATCCGAACTTGT155640.5308521124598808No Hit
TGAGGTAGTTGGTTGTATAGTT152270.5193578203820745No Hit
TCACAGTGAACCGGTCTCTT144260.49203755939001803No Hit
CCCTGAGACCCTTAACCTGTGA138020.4707543598156821No Hit
AAGCTGCCAGCTGAAGAACTGT135610.4625344061339272No Hit
TTCAAGTAATCCAGGATAGGC132940.45342765246990846No Hit
AACATTCATTGCTGTCGGTGGGT132770.45284782171227433No Hit
TCCCTGAGACCCTAACTTGT127130.4336110836354707No Hit
TCTTTGGTTATCTAGCTGTATG126060.42996156063153806No Hit
TAACAGTCTACAGTCATGGCT125270.4272670529931205No Hit
TCACAGTGAACCGGTCTCTTTT125040.4264825760857331No Hit
TTCACAGTGGCTAAGTTCTGC123300.4205478377428894No Hit
AAGCTGCCAGCTGAAGAACT111260.37948217702574105No Hit
TTGCATAGTCACAAAAGTGATC109110.37214902332625033No Hit
TAAAGCTAGAGAACCGAAAGTAA107190.3656003465341469No Hit
TTCACAGTGGCTAAGTTCTG102850.3507976083686632No Hit
CCTGTCTGAGGGTCGCT101930.3476597007391137No Hit
TACCCTGTAGAACCGAATTTGT100770.3437032085105512No Hit
TGAGATGAAGCACTGTAGCT99740.34019011627312074No Hit
TGAGGTAGTAGGTTGTATAGTTT97830.3336755471726429No Hit
CCCTGCGACCCTTAACCTGTGA96010.3274679472967949No Hit
TCCAGCATCAGTGATTTTGTTG94270.3215332089539512No Hit
TATTGCACTTGTCCCGGCCTGT93980.3205440858968106No Hit
AACCCGTAGATCCGAACTTGTGA87530.29854462479833827No Hit
TAAAGCTAGAGAACCGAAAGTAT87440.2982376555737084No Hit
AGCTACATCTGGCTACTGGGTCT86950.29656637868405705No Hit
TAAAGGGAATTTGCGACTGTT85670.29220059415598815No Hit
TTCACCGTGGCTAAGTTCTGC84760.2890967942180641No Hit
TACCCTGTAGATCCGGATTTGT83120.28350313279147576No Hit
TGAGATGAAGCACTGTAGCTCT80730.27535139449297213No Hit
TCCCTGAGACCCTAACTTGTG78500.26774537926047703No Hit
TTCCCTTTGTCATCCTATGCCT76510.26095794862699484No Hit
ACCGTGGCTTTAGATTGTTACT75470.25741074869793884No Hit
TCTTTGGTTATCTAGCTGTATGT73670.2512713642053419No Hit
AGCTACATTGTCTGCTGGGTTT73520.25075974883095886No Hit
TTCACCGTGGCTAAGTTCTG70320.23984528751078657No Hit
CCTTGGCTTTAGACTGCTTACT67610.2306021030802656No Hit
CTTTGGTTATCTAGCTGTATGA65870.2246673647374219No Hit
TCCCTGAGACCCTTAACCTG65650.22391699552166008No Hit
AGCTACATTGTCTGCTGGGTTTC65020.22176821094925117No Hit
TGAGGTAGTTGGTTGTATTGTT62610.2135482572674964No Hit
AAGCTGCCAGTTGAAGAGCTGT61950.21129714962021084No Hit
AGCTGGTGTTGTGAATCAGGCCG61440.20955765734730838No Hit
TCCCTGAGACCCTTAACCTGTGT61290.2090460419729253No Hit
TGAGATGAAGCACTGTAGCTC60210.20536241127736715No Hit
ACCATCGACCGTTGACTGTGCC59340.2023950421059453No Hit
TTCAAGTAATCCAGGATAGGCTT57250.19526653455620777No Hit
TGAGGTAGTAGGTTGTGTGGTT55710.19001395004587485No Hit
AGAATAATGCCAGCAGTCGGTC54030.18428385785278437No Hit
AACATTCAACGCTGTCGGTGAGA53670.183055980954265No Hit
TACGACCTCAGATCAGACGAGA52980.18070255023210283No Hit
TACCCTGTAGAACCGAATTTGCG52090.17766696567742993No Hit
TTCCCTTTGTCATCCTATGCCTG51450.17548407341339545No Hit
TTCAAGTAATCCAGGATAGGTT51430.1754158580301444No Hit
AGCAGCATTGTACAGGGCTATGA51010.17398333498187177No Hit
TAAGGCACGCGGTGAATGCC48730.166206781291249No Hit
TGAGGTAGTAGATTGAATAGTT45630.15563339688733205No Hit
TACCCTGTAGAACCGAATTTGC45150.1539962276893062No Hit
AACCCGTAGATCCGAACTTG42010.14328641251888713No Hit
CATTGCACTTGTCTCGGTCTGA41280.14079655103022282No Hit
TAACAGTCTACAGCCATGGTCG40800.13915938183219698No Hit
AACATTCAACGCTGTCGGTGT40180.1370447049514136No Hit
ACCATCGACCGTTGACTGTGCCT40150.13694238187653698No Hit
TACCCTGTAGAACCGAATGTGT39420.13445252038787267No Hit
TGAGGTAGTAGTTTGTGC39320.13411144347161727No Hit
AGAATCATGCCAGCAGTCGGTC38420.1310417512253188No Hit
CATTATTACTTTTGGTACGCG38230.1303937050844336No Hit
TGCTCAGTAGTCAGTGTAGATCC37930.12937047433566742No Hit
AACATTCAACGATGTCGGTGAG37320.1272899051465096No Hit
ACCATCGACCGTTGACTGTACC37140.1266759666972499No Hit
TGAGGTAGTTGTTTGTACAGTT37080.12647132054749666No Hit
TAGCTTATCAGACTGGTGTTGG36710.12520933595735173No Hit
AACATTCAACGCTGTCGGTG36550.12466361289134313No Hit
CACCACGTTCCCGTGG36340.12394735136720683No Hit
TTCAAGTAATCAAGGATAGGCT35480.12101408988741051No Hit
TATTGCACTCGTCCCGGCCT35470.12097998219578497No Hit
TGAGGTAGTAGTTTGTGCTGTTT35120.11978621298889114No Hit
TTGCATAGTCACAAAAATGAGC34600.11801261302436312No Hit
TAGCAGCACGTAAATATTGGAG34560.11787618225786098No Hit
TGAGGTAGTAGTTTGTATAGT34470.11756921303323112No Hit
TGAGGTAGTTGGTTGTATAGT32980.11248716698102589No Hit
TGCTCAGTAGTCAGTGTAGATC32190.10979265934260836No Hit
TATGGCTTTTTATTCCTATCTG32080.10941747473472742No Hit
TGTAAACATCCTTGACTGGAAGCT32060.10934925935147635No Hit
TAACAGTCTACAGCCATGGTC31800.10846245936921234No Hit
AACATTCAACGCTGTCGGTGAT31370.1069958286293142No Hit
GTACAGTACTGTGATAACTGA31100.10607492095542465No Hit
CTGGACAACTCTTAGCGG30620.10443775175739882No Hit
TGAGGTAGTAGGTTGTGTGGTTT30600.10436953637414774No Hit
TATTGCACTCGTCCCGGCCTC30510.10406256714951788No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGCTC57.5173494E-43294.856223
AAATAGC57.5173494E-43294.856223
GGCGAAC57.5173494E-43294.856223
ATAACCA106.0388265E-73294.856223
ACCCCCA57.5173494E-43294.856223
TCACTAA106.0388265E-73294.856223
GCGTACT57.5173494E-43294.856223
GCACAAA57.5173494E-43294.856223
CAACCCG251.8189894E-122635.88523
TCACTGA1150.02578.58323
TAACTGC700.02353.468823
TAACTAA152.0376465E-62196.570823
AATAACC450.01830.475523
TAAAAAA204.828891E-61647.428123
TCGGAAT100.0030063361647.428123
CGGCGTT100.0030063361647.428123
TCAAACA204.828891E-61647.428123
GATTCCT307.3359843E-91647.428123
CATAGCT100.0030063361647.428123
GTCTAAG100.0030063361647.428123