FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_32_JM27_1_GTAGAG_L003_R1_001_TRIMMED_prinseq_good_1CZI.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_32_JM27_1_GTAGAG_L003_R1_001_TRIMMED_prinseq_good_1CZI.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3415215
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG35920410.517756568766535No Hit
TTCAAGTAATCCAGGATAGGCT2307186.75559225407478No Hit
AACATTCAACGCTGTCGGTGAGT1908705.5888135886027674No Hit
TGAGGTAGTAGGTTGTATAGTT1820525.330616081271604No Hit
TCACAGTGAACCGGTCTCTTT733512.147771077369946No Hit
AACATTCAACGCTGTCGGTGA681731.9961554397014536No Hit
TCCCTGAGACCCTTAACCTGT678051.9853801298014913No Hit
AACCCGTAGATCCGAACTTGTG506001.4816051112448265No Hit
TCCCTGAGACCCTTAACCTGTG461651.3517450585102255No Hit
TATTGCACTCGTCCCGGCCTCC458381.3421702586806394No Hit
TGAGGTAGTAGGTTGTATAGT399621.1701166690823273No Hit
TGAGGTAGTAGTTTGTGCTGTT384801.1267226221482396No Hit
TAAAGCTAGAGAACCGAAAGTA367971.077443147795966No Hit
TAAAGCTAGAGAACCGAAAGT331030.9692801185284089No Hit
TGAGGTAGTAGTTTGTATAGTT302100.8845709567333243No Hit
TCCAGCATCAGTGATTTTGTT289310.8471208986842702No Hit
AACATTCATTGCTGTCGGTGGG288350.8443099482755845No Hit
AGCTACATCTGGCTACTGGGTCTC278080.8142386350493308No Hit
TTAAAGGGAATTTGCGACTGTT272890.7990419344023728No Hit
TCCCTGAGACCCTTAACCTGTGA267960.7846065328244343No Hit
TTGCATAGTCACAAAAGTGATC221710.6491831407393093No Hit
TAGCTTATCAGACTGGTGTTGGC195200.5715599164327868No Hit
AAGCTGCCAGCTGAAGAACTGT194560.5696859494936629No Hit
TCTTTGGTTATCTAGCTGTATGA193460.5664650688170437No Hit
TCACAGTGAACCGGTCTCTT190910.5589984817939719No Hit
AACATTCATTGCTGTCGGTGGGT169410.4960449049327788No Hit
TCTTTGGTTATCTAGCTGTAT166940.4888125637770975No Hit
AACCCGTAGATCCGAACTTGT164990.48310282075945443No Hit
ACCTTGGCTTTAGACTGCTTACT161480.4728252833276968No Hit
CCACGTTCCCGTGG159690.4675840320448346No Hit
AAGCTGCCAGCTGAAGAACT157500.46117155142502014No Hit
TACCCTGTAGAACCGAATTTGT152640.44694111498104805No Hit
TCACAGTGAACCGGTCTCTTTT152620.4468825535142005No Hit
TGAGGTAGTAGGTTGTATAGTTT152400.4462383773788766No Hit
TGAGGTAGTTGGTTGTATAGTT151270.442929654501986No Hit
TTCAAGTAATCCAGGATAGGC146470.42887490245855675No Hit
TTCACAGTGGCTAAGTTCTGC139430.408261266128194No Hit
TTCACAGTGGCTAAGTTCTG136130.3985986240983364No Hit
TGAGATGAAGCACTGTAGCT133870.3919811783445552No Hit
TCCCTGAGACCCTAACTTGTGA129800.3800639198410642No Hit
TCCCTGAGACCCTAACTTGT129670.37968327030655463No Hit
TATTGCACTTGTCCCGGCCTGT128230.37546684469352587No Hit
TAACAGTCTACAGTCATGGCT126000.3689372411400161No Hit
TAAAGGGAATTTGCGACTGTT120160.35183729282051057No Hit
TTCACCGTGGCTAAGTTCTGC119890.35104671301806767No Hit
TACCCTGTAGATCCGGATTTGT119850.3509295900843724No Hit
TTCACCGTGGCTAAGTTCTG116680.3416475975890244No Hit
CCTGTCTGAGGGTCGCT116510.34114982512081965No Hit
TCCAGCATCAGTGATTTTGTTG115690.33874880498006715No Hit
TATGGCTTTTTATTCCTATCTG112960.3307551647553668No Hit
AACCCGTAGATCCGAACTTGTGA108660.31816444938312816No Hit
CCCTGAGACCCTTAACCTGTGA107150.3137430586361327No Hit
TAAAGCTAGAGAACCGAAAGTC106120.3107271430934802No Hit
AACATTCAACGCTGTCGGTGG102130.2990441304573797No Hit
TGAGATGAAGCACTGTAGCTCT99630.291723947101427No Hit
TTCCCTTTGTCATCCTATGCCTG92610.2711688722379118No Hit
CCCTGCGACCCTTAACCTGTGA91800.26879713283058315No Hit
TCCCTGAGACCCTTAACCTG90870.2660740246221688No Hit
TAAGGCACGCGGTGAATGCC88410.2588709641999113No Hit
TCCCTGAGACCCTAACTTGTG83090.24329361401844393No Hit
TCTTTGGTTATCTAGCTGTATG80700.23629551873015314No Hit
ACCATCGACCGTTGACTGTGCC80060.23442155179102925No Hit
TACCCTGTAGAACCGAATTTGCG78100.22868252803996234No Hit
TGAGATGAAGCACTGTAGCTC75150.22004471167993817No Hit
TAAAGCTAGAGAACCGAAAGTAA75060.21978118507912386No Hit
TAAAGCTAGAGAACCGAAAGTAT74400.21784865667315237No Hit
AACATTCAACGCTGTCGGTGAGA72860.21333942372588546No Hit
TGAGGTAGTAGTTTGTGC72730.21295877419137596No Hit
TGAGGTAGTAGATTGAATAGTT71580.2095914898476377No Hit
TCCCTGAGACCCTTAACCTGTGT70150.20540434496803275No Hit
TTCCCTTTGTCATCCTATGCCT69360.20309116702755173No Hit
AAGCTGCCAGTTGAAGAGCTGT68730.20124648082185162No Hit
TACCCTGTAGAACCGAATGTGT68310.20001669001805158No Hit
ACCGTGGCTTTAGATTGTTACT67650.1980841616120801No Hit
TTCAAGTAATCCAGGATAGGCTT66730.19539033413708945No Hit
AGCTGGTGTTGTGAATCAGGCCG65290.19117390852406071No Hit
TGAGGTAGTAGGTTGTGTGGTT63910.1871331673115748No Hit
CCTTGGCTTTAGACTGCTTACT63590.18619618384201286No Hit
AGCTACATCTGGCTACTGGGTCT62930.18426365543604137No Hit
AACCCGTAGATCCGAACTTG61660.1805450022912174No Hit
AGCTACATTGTCTGCTGGGTTT60970.17852463168497446No Hit
ACCATCGACCGTTGACTGTGCCT59690.17477669780672667No Hit
TACCCTGTAGAACCGAATTTGC59160.1732248189352647No Hit
TGAGGTAGTAGTTTGTGCTGTTT57090.16716370711653583No Hit
AGCTACATTGTCTGCTGGGTTTC57010.16692946124914537No Hit
AACATTCAACGCTGTCGGTGT56500.16543614384453104No Hit
AACATTCAACGCTGTCGGTG52690.15428018441005908No Hit
TATGGCTTTTTATTCCTATCTGA52460.15360672754131144No Hit
AGAATAATGCCAGCAGTCGGTC52440.15354816607446384No Hit
TGAGGTAGTTGGTTGTATTGTT52220.15290398993914No Hit
CAGGCTGGTTAGATGGTTGTCT51230.15000519733018272No Hit
TTCAAGTAATCCAGGATAGGTT50590.14813123039105883No Hit
TTGCATAGTCACAAAAGTGCTC50140.14681359738698735No Hit
TGAGGTAGTAGTTTGTATAGT50110.14672575518671593No Hit
TCCCTGAGACCCTTAACCTGTGG49990.1463743863856302No Hit
TGTGGTCGGCGTCC49740.14564236805003491No Hit
TCTTTGGTTATCTAGCTGTATGT47390.13876139569543938No Hit
CATTGCACTTGTCTCGGTCTGA46700.13674102508919644No Hit
AGAATCATGCCAGCAGTCGGTC45790.13407647834762965No Hit
TGAGGTAGTAGGTTGTGTGGTTT45290.13261244167643912No Hit
TATTGCACTCGTCCCGGCCTC44860.13135337013921525No Hit
TCACAGTGAACCGGTCTCT44180.1293622802663961No Hit
TAGCTTATCAGACTGGTGTTGG43060.1260828381229293No Hit
TGAGGTAGTTGGTTGTATAGT42950.12576075005526738No Hit
TCTTTGGTTATCTAGCTGTCTGA42590.1247066436520102No Hit
TCCCTGAGACCCTAACTTGTGC40970.11996316483735285No Hit
GTACAGTACTGTGATAACTGA40750.119318988702029No Hit
CATTATTACTTTTGGTACGCG40440.11841128596589087No Hit
TAACAGTCTACAGCCATGGTCG39930.11691796856127651No Hit
CTTTGGTTATCTAGCTGTATGA39900.1168301263610051No Hit
TATTGCACTCGTCCCGGCCT39850.11668372269388602No Hit
AGCAGCATTGTACAGGGCTATGA39750.11639091535964793No Hit
TACCCTGTAGATCCGGATTTGTG39420.11542465115666217No Hit
TAGCAGCACGTAAATATTGGAG38560.11290650808221445No Hit
TGAGGTAGTAGGTTGTATGGTT38230.11194024387922868No Hit
ACCATCGACCGTTGACTGTACC37650.11024196134064765No Hit
TGTAAACATCCTTGACTGGAAGCT37370.10942210080478096No Hit
AACATTCAACGCTGTCGGTGAT36850.1078995026667428No Hit
CTGGACAACTCTTAGCGG36640.10728460726484278No Hit
TCTTTGGTTATCTAGCTGTCT36040.10552776325941413No Hit
TAACGGAACCCATAATGCAGCTG35970.10532279812544745No Hit
TGAGGTAGTAAGTTGTGTTGTT35960.10529351739202364No Hit
TCGTGTCTTGTGTTGCAGCCAGT35790.10479574492381885No Hit
TATTGCACTTGTCCCGGCCTGTT34730.10169198718089491No Hit
TGAGGTAGTTGTTTGTACAGTT34480.10095996884529963No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGGGGGT50.00101325022839.30623
CCCAGGC50.00101325022839.30623
AAACAAA50.00101325022839.30623
ATGACAA50.00101325022839.30623
TCTGGGA50.00101325022839.30623
TAAAAAA50.00101325022839.30623
CATTTGC50.00101325022839.30623
GCGGACA50.00101325022839.30623
AAGATTT50.00101325022839.30623
TAACTAA109.463438E-72839.30623
TAACACA50.00101325022839.30623
TCACTAA50.00101325022839.30623
GCCCGCC50.00101325022839.30623
GACTTTC50.00101325022839.30623
GGTGTCC50.00101325022839.30623
CGTATGC4350.02806.670423
CAACCCG251.8189894E-122271.444823
CGTCTGC2600.02238.683623
AAATAGC202.6429916E-92129.479523
TCACTGA950.01942.683123