FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_32_JM29_1_GTCCGC_L005_R1_001_TRIMMED_prinseq_good_5G1U.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_32_JM29_1_GTCCGC_L005_R1_001_TRIMMED_prinseq_good_5G1U.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3683254
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG45351212.31280818537087No Hit
TTCAAGTAATCCAGGATAGGCT2293366.226450850253607No Hit
AACATTCAACGCTGTCGGTGAGT2001725.434650990672921No Hit
TGAGGTAGTAGGTTGTATAGTT1707874.636851001858683No Hit
AACATTCAACGCTGTCGGTGA870632.3637522690533967No Hit
TCCCTGAGACCCTTAACCTGT633211.7191591999900089No Hit
AACCCGTAGATCCGAACTTGTG601511.6330939978616736No Hit
TCACAGTGAACCGGTCTCTTT582291.5809118784639884No Hit
TATTGCACTCGTCCCGGCCTCC420311.1411377005224184No Hit
TGAGGTAGTAGGTTGTATAGT417451.1333728273966444No Hit
TAAAGCTAGAGAACCGAAAGTA386481.0492895684088037No Hit
TCCCTGAGACCCTTAACCTGTG379961.0315878296745216No Hit
TGAGGTAGTAGTTTGTGCTGTT339770.9224723573231712No Hit
TGAGGTAGTAGTTTGTATAGTT328420.8916572139743824No Hit
TCCAGCATCAGTGATTTTGTT298050.8092029493485923No Hit
TAAAGCTAGAGAACCGAAAGT294650.7999719812969727No Hit
AACATTCATTGCTGTCGGTGGG285340.7746954187791556No Hit
AGCTACATCTGGCTACTGGGTCTC255800.6944945963542021No Hit
TCTTTGGTTATCTAGCTGTATGA246920.6703854797958544No Hit
TTGCATAGTCACAAAAGTGATC236050.6408735319367059No Hit
AACCCGTAGATCCGAACTTGT233420.6337331066497179No Hit
TTAAAGGGAATTTGCGACTGTT232450.631099565764403No Hit
TCTTTGGTTATCTAGCTGTAT225310.6117145328560017No Hit
TCCCTGAGACCCTTAACCTGTGA208810.5669171878996127No Hit
TTCACAGTGGCTAAGTTCTG195840.5317037597732874No Hit
AACTCCAGTCACGTCCGCATCTCGTATGC183070.4970333297676457TruSeq Adapter, Index 18 (100% over 29bp)
CCCTGAGACCCTTAACCTGTGA178090.4835126765626264No Hit
AAGCTGCCAGCTGAAGAACTGT177280.48131353417385825No Hit
TATGGCTTTTTATTCCTATCTG174920.4749061563497929No Hit
TTCACAGTGGCTAAGTTCTGC170210.4621185506076963No Hit
AAGCTGCCAGCTGAAGAACT162440.4410230736191422No Hit
AACATTCATTGCTGTCGGTGGGT155570.4223710881736638No Hit
AACCCGTAGATCCGAACTTGTGA151220.4105608790487976No Hit
TCACAGTGAACCGGTCTCTT151120.4102893799884559No Hit
ACCTTGGCTTTAGACTGCTTACT149670.40635264361350043No Hit
TCCCTGAGACCCTAACTTGTGA149090.4047779490635183No Hit
TTCAAGTAATCCAGGATAGGC142830.3877821078861246No Hit
TGAGGTAGTTGGTTGTATAGTT141730.38479561822236535No Hit
TGAGGTAGTAGGTTGTATAGTTT139980.3800443846663847No Hit
TCCCTGAGACCCTAACTTGT131030.35574521876579784No Hit
TGAGATGAAGCACTGTAGCT127060.3449667060702303No Hit
TCACAGTGAACCGGTCTCTTTT123660.33573573801861073No Hit
TAACAGTCTACAGTCATGGCT120330.3266948193092304No Hit
AACATTCGGCGCTGTCGGTGAG117210.31822404862656767No Hit
TAGCTTATCAGACTGGTGTTGGC112760.30614234044135974No Hit
TCTTTGGTTATCTAGCTGTATG109780.2980516684431755No Hit
TATTGCACTTGTCCCGGCCTGT107900.29294748610875054No Hit
TAAAGGGAATTTGCGACTGTT104210.2829291707821399No Hit
TCCAGCATCAGTGATTTTGTTG101140.2745941496296481No Hit
TAAAGCTAGAGAACCGAAAGTAA88360.2398965697179722No Hit
TCCCTGAGACCCTTAACCTG85490.2321045466861639No Hit
TGAGATGAAGCACTGTAGCTCT83950.22792346115690093No Hit
TCCCTGAGACCCTAACTTGTG83320.2262130170767479No Hit
TACCCTGTAGAACCGAATTTGT79170.2149458060725652No Hit
AGAATAATGCCAGCAGTCGGTC78660.21356116086482224No Hit
TTCCCTTTGTCATCCTATGCCT78350.2127195137777628No Hit
AACATTCAACGCTGTCGGTGAGA77500.21041177176485795No Hit
TAAAGCTAGAGAACCGAAAGTAT77160.20948867495969598No Hit
AACATTCAACGCTGTCGGTGG76890.2087556274967732No Hit
ACCGTGGCTTTAGATTGTTACT76090.2065836350140392No Hit
TATGGCTTTTTATTCCTATCTGA73290.19898166132447018No Hit
CCTGTCTGAGGGTCGCT73170.19865586245206004No Hit
ACCATCGACCGTTGACTGTGCC73080.19841151329775247No Hit
TAAGGCACGCGGTGAATGCC71650.1945290767348654No Hit
AACCCGTAGATCCGAACTTG70060.19021224167543155No Hit
TTCCCTTTGTCATCCTATGCCTG70050.19018509176939738No Hit
AGCTACATTGTCTGCTGGGTTTC68660.18641125483064702No Hit
CCACGTTCCCGTGG68490.18594970642806605No Hit
TGAGATGAAGCACTGTAGCTC68400.18570535727375848No Hit
AGCTACATTGTCTGCTGGGTTT67440.18309896629447767No Hit
TTCACCGTGGCTAAGTTCTG67350.18285461714017007No Hit
TGAGGTAGTAGATTGAATAGTT66890.181605721462598No Hit
TTCAAGTAATCCAGGATAGGCTT66670.18100842352984617No Hit
CCTTGGCTTTAGACTGCTTACT65080.1766915884704123No Hit
TCTTTGGTTATCTAGCTGTATGT65050.17661013875230977No Hit
TGAGGTAGTAGTTTGTGC63660.17283630181355944No Hit
AACATTCAACGCTGTCGGTGT63070.17123445735754309No Hit
AACATTCAGCGCTGTCGGTGAG62630.17003986149203937No Hit
TGAGGTAGTAGTTTGTATAGT61990.16830226750585217No Hit
AGCTACATCTGGCTACTGGGTCT61740.16762351985499777No Hit
TCCCTGAGACCCTTAACCTGTGT61010.165641576714503No Hit
TTCAAGTGGTCCAGGATAGGCT58900.159912946541292No Hit
ACCATCGACCGTTGACTGTGCCT58250.15814820264907062No Hit
TTCACCGTGGCTAAGTTCTGC57120.15508026326720883No Hit
CCCTGCGACCCTTAACCTGTGA56700.15393996721377345No Hit
TGAGGTAGGAGGTTGTATAGTT56150.15244672238189383No Hit
AGCTGGTGTTGTGAATCAGGCCG56040.15214807341551792No Hit
AACATTCAACGCTGTCGGTG53370.14489904850439314No Hit
AACATTCGACGCTGTCGGTGAG53310.14473614906818807No Hit
TGCTCAGTAGTCAGTGTAGATCC53090.1441388511354362No Hit
TGAGGTAGTAGGTTGTGTGGTT52970.14381305226302613No Hit
TGAGGTAGTTGGTTGTATTGTT52620.14286280555183No Hit
TGTAAACATCCTTGACTGGAAGCT52320.14204830837080473No Hit
TGAGGTAGTAGTTTGTGCTGTTT51950.14104376184754025No Hit
AAGCTGCCAGTTGAAGAGCTGT51680.1403107143846175No Hit
CATTGCACTTGTCTCGGTCTGA51590.14006636523030994No Hit
AACATTCGGCGCTGTCGGTGAGT50120.13607532904328618No Hit
TACGACCTCAGATCAGACGAGA49730.13501648270795333No Hit
AACATTCAACGCTGTCGGTGAT49280.13379473693641547No Hit
TGCTCAGTAGTCAGTGTAGATC48650.13208429285626241No Hit
AGCAGCATTGTACAGGGCTATGA48310.13116119605110046No Hit
TGAGGTAGTTGGTTGTATAGT46970.12752310864252098No Hit
CTTTGGTTATCTAGCTGTATGA46930.12741450901838428No Hit
TTCAAGTAATCCAGGATAGGTT46560.12640996249511982No Hit
GTACAGTACTGTGATAACTGA45170.12263612555636946No Hit
TCTTTGGTTATCTAGCTGTA44750.1214958295029341No Hit
TGTGGTCGGCGTCC43570.1182921405909014No Hit
CAGGCTGGTTAGATGGTTGTCT43020.11679889575902179No Hit
TACAGTACTGTGATAACTGAAG42610.11568574961162059No Hit
TACCCTGTAGATCCGGATTTGT42450.11525135111507379No Hit
TGAGGTAGTAGGTTGTATGGTT41370.11231916126338286No Hit
TGAGGTAGTAGGTTGTGTGGTTT39600.10751362789533385No Hit
AACATTCATTGCTGTCGGTGGA38830.10542308513070235No Hit
TATTGCACTCGTCCCGGCCTC38370.10417418945313031No Hit
ACCATCGACCGTTGACTGTACC37270.10118769978937102No Hit
TCACAGTGAACCGGTCTCT37150.10086190091696091No Hit
AACATTCAACGCTGTCGGTGAA37000.1004546523264483No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGG106.0979346E-61527.609723
CGCATGC300.01527.609723
CAACCCG151.0059011E-81527.609723
TAAAAAA106.0979346E-61527.609723
GTGGACT50.00350433031527.609723
GCCGAAG50.00350433031527.609723
TCACTAA50.00350433031527.609723
CGTGTGC106.0979346E-61527.609723
TAACTAA50.00350433031527.609723
GTTGCCA50.00350433031527.609723
CGTATGC22150.01486.229723
CGTCTGC3700.01362.462823
CGGATGC1700.01302.961223
TAACTGC400.01145.707323
GCCCCTC101.5983238E-51108.208722
ACAACCC208.185452E-111108.208722
TCGCATG300.01108.208722
TACCCCT50.0066599631108.208722
CGCGGTA50.0066599631108.208722
ATCACTA1150.01108.208722