FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_32_JM31_1_GTGAAA_L006_R1_001_TRIMMED_prinseq_good_kbt3.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_32_JM31_1_GTGAAA_L006_R1_001_TRIMMED_prinseq_good_kbt3.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6885349
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG76651611.132565684034317No Hit
TTCAAGTAATCCAGGATAGGCT3582845.203570654152752No Hit
AACATTCAACGCTGTCGGTGAGT3004864.364136080829018No Hit
TGAGGTAGTAGGTTGTATAGTT2296053.334689352711097No Hit
AACCCGTAGATCCGAACTTGTG1803262.6189812600639417No Hit
AACCCGTAGATCCGAACTTGT971611.41112672720003No Hit
TAAAGCTAGAGAACCGAAAGTA912031.3245951657642916No Hit
TCCCTGAGACCCTTAACCTGT888591.2905518659983684No Hit
TCACAGTGAACCGGTCTCTTT865231.2566247549688476No Hit
AACATTCAACGCTGTCGGTGA827081.2012172512969206No Hit
TAAAGCTAGAGAACCGAAAGT707561.0276312791116327No Hit
AACTCCAGTCACGTGAAAATCTCGTATGC635360.9227709445084047TruSeq Adapter, Index 19 (96% over 29bp)
AACATTCAAGGCTGTCGGTGAG624200.9065626157802604No Hit
AACATTCATTGCTGTCGGTGGG577520.8387664880894201No Hit
TATGGCTTTTTATTCCTATCTG574610.8345401228027802No Hit
TCCCTGAGACCCTTAACCTGTG570170.8280916479324432No Hit
TTGCATAGTCACAAAAGTGATC566260.8224129234407727No Hit
TGAGGTAGTAGGTTGTATAGT529490.769009675471788No Hit
TATTGCACTCGTCCCGGCCTCC503970.7319454685594006No Hit
TTAAAGGGAATTTGCGACTGTT500910.7275012493920061No Hit
TGAGGTAGTAGTTTGTGCTGTT480960.6985266832516405No Hit
AACCCGTAGATCCGAACTTGTGA466400.6773803332263912No Hit
TCCAGCATCAGTGATTTTGTT432580.6282615449122477No Hit
TTCACAGTGGCTAAGTTCTG431590.6268237092992672No Hit
TTCACAGTGGCTAAGTTCTGC401310.5828462725709329No Hit
TCCCTGAGACCCTTAACCTGTGA379450.5510977003489583No Hit
TGAGGTAGTAGTTTGTATAGTT365160.5303434873090674No Hit
ACCTTGGCTTTAGACTGCTTACT361790.5254490367881134No Hit
AGCTACATCTGGCTACTGGGTCTC359220.5217164736311841No Hit
TGAGATGAAGCACTGTAGCT352690.5122325680223326No Hit
AACATTCAANGCTGTCGGTGAG339380.4929016670033719No Hit
AACTCCAGTCACGTGAAAATCTCGTCTGC319590.46415947833581134RNA PCR Primer, Index 19 (96% over 29bp)
AAGCTGCCAGCTGAAGAACTGT313040.45464652554285917No Hit
TCTTTGGTTATCTAGCTGTATGA312460.4538041572039413No Hit
CCCTGAGACCCTTAACCTGTGA309120.44895327745913827No Hit
TCTTTGGTTATCTAGCTGTAT300410.4363032287833195No Hit
TAGCTTATCAGACTGGTGTTGGC295240.42879453169330994No Hit
TTCAAGTAAGCCAGGATAGGCT289620.42063227296103656No Hit
AACATTCATTGCTGTCGGTGGGT274320.39841117712406443No Hit
TACCCTGTAGAACCGAATTTGT272380.39559360026630463No Hit
TGAGGTAGTTGGTTGTATAGTT266780.38746038871813177No Hit
TATGGCTTTTTATTCCTATCTGA265240.3852237555423843No Hit
AAGCTGCCAGCTGAAGAACT263620.3828709336302343No Hit
TCCCTGAGACCCTAACTTGTGA256790.37295132025987354No Hit
AACATTCAAGGCTGTCGGTGAGT245330.3563072837702199No Hit
TTCAAGTAATCCAGGATAGGC233570.33922753951905704No Hit
TCACAGTGAACCGGTCTCTT215330.3127365076192943No Hit
TCCCTGAGACCCTAACTTGT212740.3089748972782643No Hit
TAAAGGGAATTTGCGACTGTT210360.3055182823702909No Hit
TGAGGTAGTGGGTTGTATAGTT196770.2857807207739216No Hit
TACCCTGTAGATCCGGATTTGT196050.28473502214629937No Hit
TGAGGTAGTAGGTTGTATAGTTT191630.278315594460063No Hit
TAAAGCTAGAGAACCGAAAGTAT191290.2778217923303525No Hit
TGAGATGAAGCACTGTAGCTCT189950.27587563099561113No Hit
TAAAGCTAGAGAACCGAAAGTAA188990.2744813661587815No Hit
AACCCGTAGATCCGAACTTG188960.2744377953826306No Hit
AACATTCAAAGCTGTCGGTGAG187740.27266591715249294No Hit
TCACAGTGAACCGGTCTCTTTT185850.26992095825498463No Hit
TAAGGCACGCGGTGAATGCC184390.2678005138156395No Hit
TAACAGTCTACAGTCATGGCT177880.25834565539088866No Hit
TCCCTGAGACCCTTAACCTG175310.2546130922339594No Hit
TCTTTGGTTATCTAGCTGTATG169800.24661059301423938No Hit
TGAGATGAAGCACTGTAGCTC167910.24386563411673107No Hit
CCTTGGCTTTAGACTGCTTACT162310.23573242256855828No Hit
TCCCTGAGACCCTAACTTGTG159150.23114296748066077No Hit
TTCAAGTAANCCAGGATAGGCT158320.22993750934048512No Hit
CCACGTTCCCGTGG157130.2282092018864984No Hit
AACATTCAACGCTGTCGGTGG156040.2266261303530148No Hit
TCCAGCATCAGTGATTTTGTTG154110.22382307708730523No Hit
AGAATAATGCCAGCAGTCGGTC150620.21875434346174755No Hit
TACCCTGTAGAACCGAATTTGCG141300.20521835567085997No Hit
AACCCGTAGGTCCGAACTTGTG139450.2025314911415529No Hit
TACCCTGTAGAACCGAATGTGT133370.19370114717496528No Hit
AGCTACATTGTCTGCTGGGTTTC131860.19150808477536868No Hit
ACCGTGGCTTTAGATTGTTACT131000.19025905585904215No Hit
TTCCCTTTGTCATCCTATGCCT130090.18893740898246406No Hit
ACCATCGACCGTTGACTGTGCCT124690.18109466927529744No Hit
AGCTGGTGTTGTGAATCAGGCCG123790.17978754599076968No Hit
TATTGCACTTGTCCCGGCCTGT121770.17685378039660735No Hit
TCCCTGAGACCCTAACTTGTGAA120270.17467524158906106No Hit
AGCTACATTGTCTGCTGGGTTT119280.1732374059760805No Hit
TGAGGTAGTNGGTTGTATAGTT117020.16995507417271077No Hit
ACCATCGACCGTTGACTGTGCC116840.1696936495158052No Hit
ACCTTGGCTCTAGACTGCTTACT112720.1637099295910781No Hit
TACCCTGTAGAACCGAATTTGC111630.16212685805759447No Hit
CTGGACAACTCTTAGCGG107640.15633194482952134No Hit
TGAGGTAGTTGGTTGTATTGTT105940.15386293418096889No Hit
TGTAAACATCCCCGACTGGA105170.15274461759309516No Hit
TGTAAACATCCTTGACTGGAAGCT103380.1501448946160899No Hit
AACATTCAACGCTGTCGGTGAGA102890.1494332386056248No Hit
AACCCGTAGATCCGAACTTGTGT101260.1470658931014245No Hit
TTCCCTTTGTCATCCTATGCCTG101080.14680446844451892No Hit
TGCTCAGTAGTCAGTGTAGATCC97390.1414452629779551No Hit
TGCTCAGTAGTCAGTGTAGATC96150.1396443375637168No Hit
CATTATTACTTTTGGTACGCG95880.13925220057835846No Hit
TTCACAGTGGTTAAGTTCTG95870.13923767698630818No Hit
CATTGCACTTGTCTCGGTCTGA93870.13633295857624647No Hit
AAGCTGCCAGTTGAAGAGCTGT93850.13630391139214584No Hit
CAGGCTGGTTAGATGGTTGTCT92840.1348370285950647No Hit
AGCTACATCTGGCTACTGGGTCT92130.1338058535594928No Hit
AGCAGCATTGTACAGGGCTATGA91900.13347181094233568No Hit
TCTTTGGTTATCTAGCTGTA91100.132309923578311No Hit
TCCCTGAGACCCTTAACCTGTGT91080.13228087639421038No Hit
TGGACAACTCTTAGCGG90180.1309737531096826No Hit
TTCAAGTAATCCAGGATAGGCTT89490.1299716252582113No Hit
TCCCTGAGACCCTTAACCTGTGG89390.1298263893377082No Hit
TCTTTGGTTATCTAGCTGTATGT89270.12965210623310452No Hit
TTCACCGTGGCTAAGTTCTG87310.12680548219124405No Hit
TGAGGTAGTAGATTGAATAGTT86860.12615192054898017No Hit
TGAGGTAGTAGGTTGTGTGGTT86450.12555645327491752No Hit
TGAGGTAGTTGGTTGTATAGT85570.12427837717449036No Hit
ACTGGACAACTCTTAGCGG85130.12363933912427677No Hit
AACATTCAACGCTGTCGGTGT84470.12268078204895642No Hit
TTCAAGTAAACCAGGATAGGCT84380.12255006972050364No Hit
AACCCGTAGATCCGAACTTGTGG83300.12098152177907032No Hit
TTCAAGTAATCCAGGATAGGTT81910.11896274248407743No Hit
AACCCGTAGNTCCGAACTTGTG79560.11554969835225493No Hit
AACATTCAATGCTGTCGGTGAG79200.1150268490384438No Hit
TTCACCGTGGCTAAGTTCTGC77810.11300806974345091No Hit
CTTTGGTTATCTAGCTGTATGA75570.10975478512418178No Hit
TATTGCACTCGTCCCGGCCT74940.10883979882501235No Hit
ACCATCGACCGTTGACTGTACC74030.10751815194843428No Hit
TAACAGTCTACAGCCATGGTCG73730.10708244418692502No Hit
AACATTCAAAGCTGTCGGTGAGT73380.10657411846516421No Hit
AACATTCAACGCTGTCGGTG73250.10638531176851021No Hit
TACGACCTCAGATCAGACGAGA72430.10519437722038491No Hit
AACCCGTAGGTCCGAACTTGT71660.10407606063251114No Hit
TGTGGTCGGCGTCC71490.10382915956765591No Hit
AACATTCATTGCTGTCGGTGGA69650.10115681863039913No Hit
TAAAGCTAGGGAACCGAAAGTA69030.10025635592328No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATTCCG106.390577E-5698.4811423
CGTCTGC44100.0696.105423
CGTATGC88600.0682.3199523
TAACTGC450.0620.8721323
ATAACAC109.7149066E-5607.4263322
TGTAATT109.7149066E-5607.4263322
TCGTCTG44800.0598.613222
TCGTATG89350.0590.7705722
ATCACTA1300.0584.063822
GTATGCC2050.0562.192223
GATACCA101.2327424E-4561.0422421
ATACCTG101.2327424E-4561.0422421
AGGCTTC155.548518E-7561.042221
ATAACTA4600.0554.606622
CTCGTCT44800.0551.649821
CGGATGC1600.0545.688423
CTCGTAT92300.0530.953821
GATCACT3000.0523.639421
GGGACAC101.5662212E-4517.978620
CCTGCTT101.5662212E-4517.978620