FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_32_JM50_1_GTGGCC_L007_R1_001_TRIMMED_prinseq_good_yII9.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_32_JM50_1_GTGGCC_L007_R1_001_TRIMMED_prinseq_good_yII9.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6127408
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG70552311.514216125317589No Hit
TTCAAGTAATCCAGGATAGGCT3850546.284125359368921No Hit
AACATTCAACGCTGTCGGTGAGT3200365.223024156380642No Hit
TGAGGTAGTAGGTTGTATAGTT3168735.171403634293652No Hit
AACTCCAGTCACGTGGCCATCTCGTATGC1674032.7320361235941855TruSeq Adapter, Index 20 (96% over 29bp)
AACATTCAACGCTGTCGGTGA1189131.940673772662111No Hit
TCACAGTGAACCGGTCTCTTT1041121.6991197583056326No Hit
TCCCTGAGACCCTTAACCTGT821361.3404689225852104No Hit
TAAAGCTAGAGAACCGAAAGTA812791.3264825844794406No Hit
TGAGGTAGTAGGTTGTATAGT775261.265233194851722No Hit
TATTGCACTCGTCCCGGCCTCC749231.222751936871186No Hit
TGAGGTAGTAGTTTGTGCTGTT741711.2104792107853761No Hit
AACCCGTAGATCCGAACTTGTG718841.1731551089791963No Hit
TCCAGCATCAGTGATTTTGTT628541.0257844752626233No Hit
TATGGCTTTTTATTCCTATCTG622561.0160250468060883No Hit
TCCCTGAGACCCTTAACCTGTG618431.0092848395275784No Hit
AACATTCATTGCTGTCGGTGGG604170.9860123562850719No Hit
TAAAGCTAGAGAACCGAAAGT587330.9585292835078063No Hit
TGAGGTAGTAGTTTGTATAGTT546980.892677621597909No Hit
TTAAAGGGAATTTGCGACTGTT504660.8236108971362769No Hit
AACTCCAGTCACGTGGCCATCTCGTCTGC438050.7149026146129RNA PCR Primer, Index 20 (96% over 29bp)
TTGCATAGTCACAAAAGTGATC436890.7130094813337058No Hit
TACCCTGTAGAACCGAATTTGT405680.6620744040546997No Hit
TCCCTGAGACCCTTAACCTGTGA394680.6441222781313077No Hit
AGCTACATCTGGCTACTGGGTCTC376410.6143054289840011No Hit
TCTTTGGTTATCTAGCTGTATGA361460.5899068578426637No Hit
TCTTTGGTTATCTAGCTGTAT353030.5761490013395549No Hit
AACATTCATTGCTGTCGGTGGGT324990.530387400349381No Hit
AAGCTGCCAGCTGAAGAACTGT322550.5264052924172831No Hit
TGAGGTAGTTGGTTGTATAGTT304840.4975023696806219No Hit
TGAGATGAAGCACTGTAGCT287060.46848520614262995No Hit
TTCACAGTGGCTAAGTTCTG284770.4647478999276693No Hit
TACCCTGTAGATCCGGATTTGT276290.4509084428521815No Hit
TAGCTTATCAGACTGGTGTTGGC270320.4411653345101224No Hit
TCACAGTGAACCGGTCTCTT269530.4398760454665333No Hit
TCCCTGAGACCCTAACTTGTGA268030.43742802829516164No Hit
CCCTGAGACCCTTAACCTGTGA264930.43236879280766033No Hit
TTCACAGTGGCTAAGTTCTGC256190.4181050127558015No Hit
TGAGGTAGTAGGTTGTATAGTTT252550.4121644910866063No Hit
TATGGCTTTTTATTCCTATCTGA250300.4084924653295488No Hit
TTCAAGTAATCCAGGATAGGC246890.4029273062932973No Hit
ACCTTGGCTTTAGACTGCTTACT238260.3888430475006724No Hit
AACCCGTAGATCCGAACTTGT236260.3855790246055102No Hit
TCACAGTGAACCGGTCTCTTTT220330.3595810822455433No Hit
AAGCTGCCAGCTGAAGAACT219100.35757370816501854No Hit
TAAAGGGAATTTGCGACTGTT211220.3447134579580795No Hit
TATTGCACTTGTCCCGGCCTGT210670.34381585166190987No Hit
CCACGTTCCCGTGG206540.33707564438339993No Hit
TCCAGCATCAGTGATTTTGTTG198800.32444387577912226No Hit
TGAGATGAAGCACTGTAGCTCT193950.31652862025835393No Hit
TAACAGTCTACAGTCATGGCT191480.31249755198282864No Hit
TACCCTGTAGAACCGAATGTGT187880.3066223107715367No Hit
TACCCTGTAGAACCGAATTTGCG185700.3030645258158099No Hit
TAAGGCACGCGGTGAATGCC177870.2902858761812499No Hit
TCTTTGGTTATCTAGCTGTATG168730.27536929155035866No Hit
TTCACCGTGGCTAAGTTCTG165360.26986941297201034No Hit
TCCCTGAGACCCTAACTTGT163370.26662171019132397No Hit
TGAGATGAAGCACTGTAGCTC162930.2659036251543883No Hit
TACCCTGTAGAACCGAATTTGC161790.2640431321041458No Hit
CCCTGCGACCCTTAACCTGTGA159450.26022422531680606No Hit
TAAAGCTAGAGAACCGAAAGTAT154080.25146032384329553No Hit
TTCACCGTGGCTAAGTTCTGC152190.24837582220736729No Hit
TAAAGCTAGAGAACCGAAAGTAA147140.24013416439708277No Hit
AACCCGTAGATCCGAACTTGTGA145440.2373597449361949No Hit
TTCCCTTTGTCATCCTATGCCT144100.2351728495964362No Hit
AGAATAATGCCAGCAGTCGGTC138270.2256582228570384No Hit
TTCCCTTTGTCATCCTATGCCTG136450.22268796202244082No Hit
ACCGTGGCTTTAGATTGTTACT134200.21901593626538332No Hit
CCTGTCTGAGGGTCGCT130580.21310805482513975No Hit
TCCCTGAGACCCTAACTTGTG127980.20886482506142892No Hit
TGAGGTAGTTGGTTGTATTGTT122390.1997418810694506No Hit
CCTTGGCTTTAGACTGCTTACT120300.19633097714400605No Hit
TGAGGTAGTAGTTTGTGC116670.1904067755892867No Hit
AGCTGGTGTTGTGAATCAGGCCG115480.1884646819666652No Hit
ACCATCGACCGTTGACTGTGCC115400.1883341210508587No Hit
TCCCTGAGACCCTTAACCTG115350.18825252047847965No Hit
TGAGGTAGTAGATTGAATAGTT113580.18536386021626108No Hit
CATTGCACTTGTCTCGGTCTGA113440.18513537861359974No Hit
AACATTCAACGCTGTCGGTGAGA112230.18316064476202662No Hit
AAGCTGCCAGTTGAAGAGCTGT112110.1829648033883169No Hit
TGAGGTAGTAGTTTGTGCTGTTT111530.18201823674871984No Hit
TGAGGTAGTAGGTTGTGTGGTT111260.18157759365787293No Hit
TTCAAGTAATCCAGGATAGGCTT108150.17650203805589573No Hit
AACCCGTAGATCCGAACTTG106870.17441306340299192No Hit
TGTGGTCGGCGTCC103490.16889686471016782No Hit
ACCATCGACCGTTGACTGTGCCT102160.16672628948488497No Hit
AACATTCAACGCTGTCGGTGG102090.16661204868355428No Hit
AACATTCAACGCTGTCGGTGT99330.16210769708823047No Hit
TGAGGTAGTAGTTTGTATAGT97750.15952911900105232No Hit
TCTTTGGTTATCTAGCTGTA96500.15748910469157593No Hit
TTCAAGTAATCAAGGATAGGCT96140.15690158057044676No Hit
TTCAAGTAATCCAGGATAGGTT94640.1544535633990751No Hit
TGAGGTAGTTGGTTGTATAGT94160.1536701979042362No Hit
CTGGACAACTCTTAGCGG93380.15239722897512292No Hit
TCTTTGGTTATCTAGCTGTATGT91170.1487904836759687No Hit
TGTAAACATCCTTGACTGGAAGCT90580.14782759692189587No Hit
CATTATTACTTTTGGTACGCG89440.1459671038716534No Hit
TATTGCACTCGTCCCGGCCT88420.1443024521951207No Hit
CAGGCTGGTTAGATGGTTGTCT87630.1430131631515316No Hit
CTTTGGTTATCTAGCTGTATGA86870.14177283445136998No Hit
AGCTACATCTGGCTACTGGGTCT86520.1412016304447166No Hit
AACATTCAACGCTGTCGGTG86440.1410710695289101No Hit
AGCTACATTGTCTGCTGGGTTTC86370.14095682872757942No Hit
TCCCTGAGACCCTTAACCTGTGT84990.13870465292991752No Hit
TACCCTGTAGATCCGGATTTGTG84650.13814976903773993No Hit
AGCAGCATTGTACAGGGCTATGA83900.1369257604520541No Hit
ACCATCGACCGTTGACTGTACC83810.1367788794217718No Hit
AGCTACATTGTCTGCTGGGTTT83400.13610975472826356No Hit
AGAATCATGCCAGCAGTCGGTC79020.12896154458785836No Hit
TAGCAGCACGTAAATATTGGAG77540.12654616764543833No Hit
TGAGGTAGTAGGTTGTATGGTT75960.1239675895582602No Hit
TGAGGTAGTAGGTTGTGTGGTTT75950.1239512694437844No Hit
TCGTGTCTTGTGTTGCAGCCAGT75570.12333110509370358No Hit
TACAGTACTGTGATAACTGAAG75190.12271094074362274No Hit
AACATTCAACGATGTCGGTGAG74270.12120949021184814No Hit
TACGACCTCAGATCAGACGAGA73880.12057300574729152No Hit
GTACAGTACTGTGATAACTGA73550.12003444196958975No Hit
AACATTCATTGCTGTCGGTGGA71290.11634609609805648No Hit
TGGACAACTCTTAGCGG70210.11458352373466887No Hit
TGAGGTAGTAAGTTGTGTTGTT69200.11293519217261197No Hit
TAACAGTCTACAGCCATGGTCG66750.10893676412603828No Hit
TATTGCACTCGTCCCGGCCTC66030.10776171588377989No Hit
TTGCATAGTCACAAAAATGAGC65830.10743531359426368No Hit
TAGCTTATCAGACTGGTGTTGG63800.10412233035567404No Hit
AACATTCAACGCTGTCGGTGAT62640.10222919707647997No Hit
TGTAAACATCCCCGACTGGA61790.10084198734603604No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACACCCA152.259596E-6394.7982823
CAACCCG152.259596E-6394.7982823
CGTTTGC152.259596E-6394.7982823
CGTCTGC46800.0391.0021423
CGTATGC177250.0388.7844223
CGTGTGC1350.0380.1761223
ACAACCC350.0355.1541422
ATAAAAA153.4484365E-6355.1541422
ATCAACA202.4467226E-8355.154122
TCGTCTG46900.0351.3678622
ATCACTA3400.0349.9312722
TCGTATG178550.0347.8939522
TCGTGTG1350.0342.000322
ATAACTA5600.0332.9570322
ATCACTG2250.0331.477222
GACAACC500.0331.4092721
CTCGTGT1350.0331.4092421
GATCAAC203.4564437E-8331.4092421
GAACATA105.9714593E-4331.4092421
CTCGTCT46750.0329.2825621