FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_32_JM77_1_GTTTCG_L008_R1_001_TRIMMED_prinseq_good_TTzF.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_32_JM77_1_GTTTCG_L008_R1_001_TRIMMED_prinseq_good_TTzF.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6218651
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG6108839.823400605694065No Hit
TTCAAGTAATCCAGGATAGGCT4022716.468782377399858No Hit
AACATTCAACGCTGTCGGTGAGT3459505.563103637750374No Hit
TGAGGTAGTAGGTTGTATAGTT2073863.334903341576815No Hit
TCACAGTGAACCGGTCTCTTT1311222.1085280392805448No Hit
AACATTCAACGCTGTCGGTGA1165741.8745866265850908No Hit
TCCCTGAGACCCTTAACCTGTG770021.2382428279059237No Hit
TATTGCACTCGTCCCGGCCTCC638681.0270394656333022No Hit
TGAGGTAGTAGTTTGTGCTGTT581570.9352028277515493No Hit
TCCCTGAGACCCTTAACCTGT579440.9317776475959174No Hit
TAAAGCTAGAGAACCGAAAGTA536400.8625664955309439No Hit
TGAGGTAGTAGGTTGTATAGT531900.8553301994274963No Hit
AACCCGTAGATCCGAACTTGTG530490.8530628266484162No Hit
TAAAGCTAGAGAACCGAAAGT506530.8145335700620602No Hit
TCCAGCATCAGTGATTTTGTT503360.8094360014736315No Hit
TCTTTGGTTATCTAGCTGTAT490470.7887080333017562No Hit
AACATTCATTGCTGTCGGTGGG488380.7853471757781552No Hit
TCTTTGGTTATCTAGCTGTATGA485630.7809249948260483No Hit
TTAAAGGGAATTTGCGACTGTT470220.7561447008362424No Hit
TCCCTGAGACCCTTAACCTGTGA467340.751513471330036No Hit
AACTCCAGTCACGTTTCGATCTCGTATGC463590.7454832245771631TruSeq Adapter, Index 21 (96% over 29bp)
AACANTCAACGCTGTCGGTGAG460200.740031881512566No Hit
AACAGTCAACGCTGTCGGTGAG457600.7358509104305742No Hit
TGAGGTAGTAGTTTGTATAGTT442990.7123570690813812No Hit
CCACGTTCCCGTGG374860.6027995460751857No Hit
TCACAGTGAACCGGTCTCTT323180.519694705491593No Hit
AACATTCATTGCTGTCGGTGGGT305720.4916178766102166No Hit
TTCANGTAATCCAGGATAGGCT300780.483674031554432No Hit
AGCTACATCTGGCTACTGGGTCTC298480.4799754802126699No Hit
TTCAGGTAATCCAGGATAGGCT296600.47695231650722963No Hit
TAAAGCTAGAGAACCGAAAGTC285450.4590223828286874No Hit
TAGCTTATCAGACTGGTGTTGGC279490.4494383106561214No Hit
TGAGGTAGTTGGTTGTATAGTT275190.44252362771282705No Hit
TCACAGTGAACCGGTCTCTTTT274700.4417356754704517No Hit
TCTTTGGTTATCTAGCTGTATG263180.4232107574456261No Hit
AACANTCAACGCTGTCGGTGAGT260590.4190458670216418No Hit
AACAGTCAACGCTGTCGGTGAGT254280.40889897181880763No Hit
AAGCTGCCAGCTGAAGAACTGT253480.4076125191781948No Hit
TTCAAGTAATCCAGGATAGGC249350.40097120742103065No Hit
ACCTTGGCTTTAGACTGCTTACT241160.3878011485127562No Hit
CACTCCAGTCACGTTTCGATCTCGTATGC235550.3787798993704583RNA PCR Primer, Index 21 (96% over 29bp)
TTCACAGTGGCTAAGTTCTGC230970.37141495800294955No Hit
TTGCATAGTCACAAAAGTGATC227500.36583496967429113No Hit
TCCCTGAGACCCTAACTTGTGA224160.36046402989973225No Hit
AAGCTGCCAGCTGAAGAACT222810.35829314106869803No Hit
TATTGCACTTGTCCCGGCCTGT214040.3441904039959792No Hit
TAAAGGGAATTTGCGACTGTT208640.33550684867184216No Hit
TAACAGTCTACAGTCATGGCT200710.3227548868717669No Hit
TTCACAGTGGCTAAGTTCTG190730.3067063901801211No Hit
CCTGTCTGAGGGTCGCT189000.30392443634479566No Hit
TCCAGCATCAGTGATTTTGTTG186840.30045101421514087No Hit
CCCTGAGACCCTTAACCTGTGA179010.2878598589951422No Hit
TGAGATGAAGCACTGTAGCTCT161340.25944533629560496No Hit
TTCCCTTTGTCATCCTATGCCT157530.25331860559468605No Hit
TGAGGTAGTAGGTTGTATAGTTT149000.2396018043141511No Hit
TGAGNTAGTAGGTTGTATAGTT147750.23759172206319346No Hit
TGAGATGAAGCACTGTAGCT144550.2324459115007419No Hit
TTCCCTTTGTCATCCTATGCCTG142560.2292458605572173No Hit
TCTTTGGTTATCTAGCTGTATGT140320.22564379316350122No Hit
TAAGGCACGCGGTGAATGCC138740.22310304919829077No Hit
TCCCTGAGACCCTAACTTGTG136720.21985475628074322No Hit
AGCTGGTGTTGTGAATCAGGCCG135720.21824669047997708No Hit
ACCATCGACCGTTGACTGTGCC132020.21229684701714246No Hit
TGAGGTAGTAGGTTGTGTGGTT128760.20705455250664492No Hit
TGAGGTAGTTGGTTGTATTGTT127880.20563945460197072No Hit
TTCACCGTGGCTAAGTTCTGC126700.20374193695706674No Hit
AAGCTGCCAGTTGAAGAGCTGT125750.2022142744463389No Hit
TCCCTGAGACCCTAACTTGTGC125620.20200522589223932No Hit
ACCGTGGCTTTAGATTGTTACT125520.2018444193121627No Hit
AACATTCAACGCTGTCGGTGG120640.1939970582044241No Hit
TTCAAGTAATCCAGGATAGGCTT117800.18943015133024832No Hit
AGAATAATGCCAGCAGTCGGTC116160.18679292341699189No Hit
AACCCGTAGATCCGAACTTGT115510.1857476806464939No Hit
AACAATCAACGCTGTCGGTGAG115390.18555471275040197No Hit
AACATTCAACGCTGTCGGTGAGA111960.18003904705377421No Hit
TTCACCGTGGCTAAGTTCTG107090.17220776660404322No Hit
CCTTGGCTTTAGACTGCTTACT104350.16780166630994406No Hit
AACATTCAACGCTGTCGGTGT104120.16743181117576786No Hit
TGAGATGAAGCACTGTAGCTC103930.1671262786736223No Hit
TAAAGCTAGAGAACCGAAAGTAA102520.16485890589454208No Hit
TCCCTGAGACCCTAACTTGT100150.1610477899467264No Hit
TGAGGTAGTAGTTTGTGCTGTTT97850.15734923860496433No Hit
TCACNGTGAACCGGTCTCTTT97840.15733315794695665No Hit
TCACGGTGAACCGGTCTCTTT95730.15394013910734017No Hit
CCCTGCGACCCTTAACCTGTGA94220.15151195974818332No Hit
TTCAAGTAATCCAGGATAGGTT93810.15085265276986923No Hit
CCCTGAGACCCTTAACCTGTGC93000.14955011947124866No Hit
AACATTCAACGCTGTCGGTG92200.14826366683063577No Hit
AGCTACATCTGGCTACTGGGTCT92020.14797421498649788No Hit
AGCTACATTGTCTGCTGGGTTT91930.14782948906442892No Hit
TGAGGTAGTAGATTGAATAGTT91170.14660735905584668No Hit
ACCATCGACCGTTGACTGTACC90970.14628574589569346No Hit
ACCATCGACCGTTGACTGTGCCT90420.1454013097052721No Hit
TGAGGTAGTAGTTTGTGC87380.1405127896709431No Hit
TACCCTGTAGAACCGAATTTGT87000.139901724666652No Hit
CTTTGGTTATCTAGCTGTATGA86900.13974091808657538No Hit
AACAGTCAACGCTGTCGGTGA86210.13863135268404675No Hit
CACCACGTTCCCGTGG86040.1383579814979165No Hit
TCCCTGAGACCCTTAACCTG80050.12872566735132748No Hit
AGCAGCATTGTACAGGGCTATGA79860.1284201348491819No Hit
TGTAAACATCCTTGACTGGAAGCT78110.12560601969784121No Hit
TGAGGTAGTTGGTTGTATAGT76870.12361201810489125No Hit
TAAAGCTAGAGAACCGAAAGTAT76600.12317784033868438No Hit
TGAGGTAGTAGTTTGTGCTGT74060.11909335320473846No Hit
TATTGCACTCGTCCCGGCCT73640.11841796556841669No Hit
TCACAGTGAACCGGTCTCT72100.11594154423523687No Hit
TGAGGTAGTTGTTTGTACAGTT69640.11198570236535223No Hit
TGAGGTAGTAGTTTGTATAGT68840.11069924972473934No Hit
GTACAGTACTGTGATAACTGA68020.10938063576811112No Hit
AACCCGTAGATCCGAACTTG67760.10896253865991193No Hit
TCCCTGAGACCCTTAACCTGTGT67480.10851228023569742No Hit
TAGCAGCACGTAAATATTGGAG67320.10825498970757484No Hit
AACCCGTAGATCCGAACTTGTGA67260.10815850575952887No Hit
CAGGCTGGTTAGATGGTTGTCT66660.1071936662790692No Hit
AACAATCAACGCTGTCGGTGAGT65020.10455643836581277No Hit
TCGTGTCTTGTGTTGCAGCCAGT64910.1043795511277285No Hit
AACATTCAACGCTGTCGGTGAT64610.10389713138749866No Hit
AGCTACATTGTCTGCTGGGTTTC63950.10283580795899304No Hit
AAGGTCCAACCTCACATGTCCT63780.10256243677286278No Hit
TAGCTTATCAGACTGGTGTTGG63610.10228906558673255No Hit
AGAATCATGCCAGCAGTCGGTC63360.10188704913654102No Hit
TATTGCACTCGTCCCGGCCTC62740.10089004834006603No Hit
AACATTCATTGCTGTCGGTGGGTT62460.10043978991585152No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGCGCA50.009689517918.931523
ACACAAC50.009689517918.931523
GCACGCC50.009689517918.931523
CGTTACT50.009689517918.931523
GCACACT50.009689517918.931523
CTAAAAT50.009689517918.931523
ACATAGC50.009689517918.931523
TGAGCCT50.009689517918.931523
CCCATCT50.009689517918.931523
CGTATGC75900.0905.6136523
CAACCCG400.0804.0650623
TCACTAA256.4574124E-10735.1451423
TAACTAA256.4574124E-10735.1451423
CTAAACA207.9671736E-10704.8832422
TACTAAC207.9671736E-10704.8832422
TGGTATG106.217392E-5704.8832422
CTCAAAA152.2273889E-7704.883222
TCGTATG76350.0691.95822
ATCACTA1550.0682.1449622
ATCACTG1400.0654.534422