FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_39_JM13_1_GAGTGG_L002_R1_001_TRIMMED_prinseq_good_8zHb.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_39_JM13_1_GAGTGG_L002_R1_001_TRIMMED_prinseq_good_8zHb.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3305898
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG3237649.793526600034241No Hit
TTCAAGTAATCCAGGATAGGCT2348727.104635412223851No Hit
AACATTCAACGCTGTCGGTGAGT1766075.342179341286392No Hit
TGAGGTAGTAGGTTGTATAGTT1396974.225689963816186No Hit
AACTCCAGTCACGAGTGGATCTCGTATGC1045523.1625900133639937RNA PCR Primer, Index 23 (100% over 29bp)
TCACAGTGAACCGGTCTCTTT657341.9883856065734635No Hit
AACATTCAACGCTGTCGGTGA586281.773436446012551No Hit
TCCCTGAGACCCTTAACCTGTG468951.418525314453138No Hit
AACTCCAGTCCCGAGTGGATCTCGTATGC457171.3828920311515964RNA PCR Primer, Index 23 (96% over 29bp)
TAAAGCTAGAGAACCGAAAGTA436491.3203371670874298No Hit
AACCCGTAGATCCGAACTTGTG391281.1835815866067254No Hit
TATTGCACTCGTCCCGGCCTCC376091.137633405507369No Hit
TCCCTGAGACCCTTAACCTGT356421.0781336871252531No Hit
TGAGGTAGTAGGTTGTATAGT349701.057806381201114No Hit
AGCTACATCTGGCTACTGGGTCTC315850.9554136274016923No Hit
TGAGGTAGTAGTTTGTGCTGTT297390.8995740340446077No Hit
TCTTTGGTTATCTAGCTGTATGA292550.8849335339444835No Hit
TGAGGTAGTAGTTTGTATAGTT285490.8635777631372776No Hit
TCCAGCATCAGTGATTTTGTT279800.8463661008294873No Hit
TAAAGCTAGAGAACCGAAAGT276350.8359302071630764No Hit
TCTTTGGTTATCTAGCTGTAT267300.8085548918932163No Hit
TCCCTGAGACCCTTAACCTGTGA259610.7852934361556225No Hit
AACATTCATTGCTGTCGGTGGG254220.7689892428623024No Hit
TCCCTGAGACCCTAACTTGTGA227160.6871355377570633No Hit
TTAAAGGGAATTTGCGACTGTT198270.599746271663554No Hit
CCACGTTCCCGTGG176340.5334102867057604No Hit
AAGCTGCCAGCTGAAGAACTGT174980.5292964271734941No Hit
TCACAGTGAACCGGTCTCTT171090.5175295789525266No Hit
AAGCTGCCAGCTGAAGAACT167380.5063072121402415No Hit
ACCTTGGCTTTAGACTGCTTACT157210.4755440125496915No Hit
TGAGGTAGTTGGTTGTATAGTT153860.46541060855477084No Hit
AACATTCATTGCTGTCGGTGGGT152050.4599355455007989No Hit
TAGCTTATCAGACTGGTGTTGGC149520.45228255681209767No Hit
TCTTTGGTTATCTAGCTGTATG147410.44590002474365514No Hit
CCCTGAGACCCTTAACCTGTGA141490.42799263619143724No Hit
TCACAGTGAACCGGTCTCTTTT140290.42436276013355523No Hit
TTCACAGTGGCTAAGTTCTGC138770.4197649171269047No Hit
TACCCTGTAGAACCGAATTTGT137530.4160140452004266No Hit
TTCAAGTAATCCAGGATAGGC135490.4098432559020272No Hit
TAACAGTCTACAGTCATGGCT123850.3746334581405718No Hit
TTCACAGTGGCTAAGTTCTG115490.34934532160399384No Hit
TGAGATGAAGCACTGTAGCT108400.327898803895341No Hit
TATTGCACTTGTCCCGGCCTGT108030.3267795921108274No Hit
TTGCATAGTCACAAAAGTGATC107080.3239059402316708No Hit
TGAGGTAGTAGGTTGTATAGTTT105090.31788639576901645No Hit
TACCCTGTAGATCCGGATTTGT102940.3113828678319779No Hit
TGAGATGAAGCACTGTAGCTCT100550.30415336468336285No Hit
AACCCGTAGATCCGAACTTGT100230.30318539773459435No Hit
TCCAGCATCAGTGATTTTGTTG99870.30209643491722976No Hit
CCCTGCGACCCTTAACCTGTGA97780.29577440078308526No Hit
TTCACCGTGGCTAAGTTCTGC95990.2903598356634113No Hit
AGCTACATCTGGCTACTGGGTCT94020.28440078913505495No Hit
TAAAGCTAGAGAACCGAAAGTAA92740.28052892133998086No Hit
TCCCTGAGACCCTAACTTGTG88970.2691250607248015No Hit
TCTTTGGTTATCTAGCTGTATGT87970.2661001640098999No Hit
TAAAGGGAATTTGCGACTGTT86540.2617745617075905No Hit
ACCGTGGCTTTAGATTGTTACT85600.2589311587955829No Hit
AGCTACATTGTCTGCTGGGTTT85050.257267465602387No Hit
TTCCCTTTGTCATCCTATGCCT84930.2569044779965988No Hit
TTCACCGTGGCTAAGTTCTG81850.24758779611470166No Hit
CCTGTCTGAGGGTCGCT80340.24302020207520014No Hit
AAGCTGCCAGTTGAAGAGCTGT78400.2371519024482909No Hit
AACTCCAGTCACGCGTGGATCTCGTATGC75300.22777472263209572RNA PCR Primer, Index 23 (96% over 29bp)
TAAAGCTAGAGAACCGAAAGTAT73920.22360036516553142No Hit
TGAGGTAGTAGGTTGTGTGGTT72520.21936550976466906No Hit
ACCATCGACCGTTGACTGTGCC71890.21745982483428106No Hit
CTTTGGTTATCTAGCTGTATGA71290.21564488680534005No Hit
AGAATAATGCCAGCAGTCGGTC71290.21564488680534005No Hit
AGCTACATTGTCTGCTGGGTTTC71250.21552389093674398No Hit
TACCCTGTAGAACCGAATTTGCG70670.213769450842101No Hit
TCCCTGAGACCCTAACTTGT70010.21177301901026588No Hit
TTCAAGTAATCCAGGATAGGCTT68940.20853637952532111No Hit
AACCCGTAGATCCGAACTTGTGA67850.20523924210607827No Hit
TAAGGCACGCGGTGAATGCC65590.1984029755304005No Hit
AGCTGGTGTTGTGAATCAGGCCG63130.1909617296117424No Hit
TGAGGTAGTTGGTTGTATTGTT63050.19071973787455027No Hit
AACATTCAACGCTGTCGGTGAGA61880.18718060871811534No Hit
TACCCTGTAGAACCGAATGTGT61320.18548666655777038No Hit
TGAGATGAAGCACTGTAGCTC61150.1849724341162371No Hit
AACTCCAGTCCCGCGTGGATCTCGTATGC60690.18358098162738234No Hit
TACGACCTCAGATCAGACGAGA59760.18076782768252378No Hit
CCTTGGCTTTAGACTGCTTACT59400.1796788648651592No Hit
TTCCCTTTGTCATCCTATGCCTG57980.17538351152999881No Hit
CATTGCACTTGTCTCGGTCTGA55480.16782126974274464No Hit
TACCCTGTAGAACCGAATTTGC54400.16455438129065084No Hit
ACCATCGACCGTTGACTGTGCCT52800.15971454654680814No Hit
AACTCCAGTCACGAGTGGATCT51120.15463272006577336RNA PCR Primer, Index 23 (100% over 22bp)
TGAGGTAGTAGTTTGTGCTGTTT51100.1545722221314753No Hit
TGAGGTAGTAGATTGAATAGTT50620.15312027170832251No Hit
TTCAAGTAATCCAGGATAGGTT50330.15224305166100105No Hit
AACCCGTAGATCCGAACTTG49530.1498231342890797No Hit
AGAATCATGCCAGCAGTCGGTC49420.1494903956504405No Hit
TCCCTGAGACCCTTAACCTG47490.14365234499068028No Hit
TCGTGTCTTGTGTTGCAGCCAGT47280.14301711668055092No Hit
AGCAGCATTGTACAGGGCTATGA46950.1420189007646334No Hit
TGAGGTAGTAGTTTGTATAGT46570.14086944001297078No Hit
AACATTCAACGCTGTCGGTGT46170.1396594813270101No Hit
TCCCTGAGACCCTTAACCTGTGT44990.13609010320342613No Hit
AACATTCAACGCTGTCGGTG44870.13572711559763792No Hit
TATTGCACTCGTCCCGGCCT44180.13363993686435577No Hit
AACATTCAACGCTGTCGGTGG43830.1325812230141402No Hit
TGTGGTCGGCGTCC43700.13218798644120294No Hit
ACCATCGACCGTTGACTGTACC43190.1306452891166031No Hit
TGAGGTAGTTGGTTGTATAGT43060.1302520525436659No Hit
TGAGGTAGTAGTTTGTGC43000.1300705587407718No Hit
TGCTCAGTAGTCAGTGTAGATCC40600.12281080662500778No Hit
TGAGGTAGTAGGTTGTGTGGTTT39170.11848520432269839No Hit
GTACAGTACTGTGATAACTGA38810.1173962415053338No Hit
TTCAAGTAATCAAGGATAGGCT38610.11679126216235347No Hit
CACCACGTTCCCGTGG38080.11518806690345557No Hit
TAACAGTCTACAGCCATGGTCG37790.11431084685613409No Hit
TCACAGTGAACCGGTCTCT36960.11180018258276571No Hit
AACATTCAACGATGTCGGTGAG36820.11137669704267947No Hit
TACCCTGTAGATCCGGATTTGTG36600.11071121976540112No Hit
TAGCTTATCAGACTGGTGTTGG35800.10829130239347977No Hit
CAGGCTGGTTAGATGGTTGTCT34600.10466142633559776No Hit
TAACGGAACCCATAATGCAGCTG34030.10293723520810381No Hit
TACAGTACTGTGATAACTGAAG33940.10266499450376267No Hit
TAGCAGCACGTAAATATTGGAG33380.10097105234341773No Hit
TGCTCAGTAGTCAGTGTAGATC33160.10030557506613937No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC172100.0273.6910723
ATCACTG1450.0248.080522
ATCACTA1500.0248.0804922
AAAAACC100.0014211992248.0804922
CGATGTA100.0014211992248.0804922
TACTAAC201.4646685E-7248.0804922
ATAACCA100.0014211992248.0804922
ATAACAC100.0014211992248.0804922
TCGTATG172400.0245.5622722
GTATGCC1700.0235.7713223
ACAACCC850.0233.4875222
TCACTGA1200.0230.3512923
CACATCT100.0018035126229.1077621
GAAAACA500.0229.1077621
GAAAAAC151.9834977E-5229.1077621
GAACACC400.0229.1077621
GAACACA202.1782034E-7229.1077621
ATAACTA5200.0228.9973822
CTCGTAT174650.0225.6970521
ATAAACA500.0223.2724522