FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_39_JM15_1_GGTAGC_L003_R1_001_TRIMMED_prinseq_good_J1F2.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_39_JM15_1_GGTAGC_L003_R1_001_TRIMMED_prinseq_good_J1F2.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3804979
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG41574610.926367793357073No Hit
TTCAAGTAATCCAGGATAGGCT3063728.051870982730785No Hit
AACATTCAACGCTGTCGGTGAGT2122285.5776391932780705No Hit
TGAGGTAGTAGGTTGTATAGTT1707944.488697572312488No Hit
AACATTCAACGCTGTCGGTGA716181.8822180096131937No Hit
TCACAGTGAACCGGTCTCTTT706081.855673842089536No Hit
TCCCTGAGACCCTTAACCTGTG551831.4502839568891182No Hit
TCCAGCATCAGTGATTTTGTT467591.2288898309294216No Hit
TGAGGTAGTAGGTTGTATAGT439961.156274449872128No Hit
TAAAGCTAGAGAACCGAAAGTA372850.9799002832867146No Hit
AACCCGTAGATCCGAACTTGTG371030.9751170768616594No Hit
TATTGCACTCGTCCCGGCCTCC360850.948362658506131No Hit
TCCCTGAGACCCTTAACCTGT352160.9255241618941917No Hit
TAAAGCTAGAGAACCGAAAGT334770.8798208873163296No Hit
AGCTACATCTGGCTACTGGGTCTC322610.8478627608720047No Hit
TGAGGTAGTAGTTTGTGCTGTT320590.8425539273672733No Hit
TCCCTGAGACCCTTAACCTGTGA316140.8308587248444734No Hit
TCTTTGGTTATCTAGCTGTATGA312970.8225275356316027No Hit
TCTTTGGTTATCTAGCTGTAT293650.7717519597348632No Hit
TGAGGTAGTAGTTTGTATAGTT285840.7512262222735001No Hit
AACATTCATTGCTGTCGGTGGG282920.7435520669102248No Hit
TTAAAGGGAATTTGCGACTGTT262900.6909367962346179No Hit
CCACGTTCCCGTGG261100.6862061525175304No Hit
TAGCTTATCAGACTGGTGTTGGC219650.577269940254598No Hit
AAGCTGCCAGCTGAAGAACT206430.5425259902879884No Hit
TCACAGTGAACCGGTCTCTT201160.5286757167385154No Hit
TGAGGTAGTTGGTTGTATAGTT200590.5271776795614378No Hit
TCCCTGAGACCCTAACTTGTGA197080.5179529243131171No Hit
TTCAAGTAATCCAGGATAGGC193620.5088595758347155No Hit
AAGCTGCCAGCTGAAGAACTGT189530.4981105020553333No Hit
TGAGATGAAGCACTGTAGCT186380.4898318755504301No Hit
AACTCCAGTCACGGTAGCATCTCGTATGC177690.46699337893849086RNA PCR Primer, Index 24 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGC177110.46546906040742936No Hit
ACCTTGGCTTTAGACTGCTTACT175940.46239414199132245No Hit
TTCACAGTGGCTAAGTTCTG173420.4557712407873999No Hit
AACATTCATTGCTGTCGGTGGGT167490.4401863978749948No Hit
TAACAGTCTACAGTCATGGCT151850.399082360244301No Hit
TTCACCGTGGCTAAGTTCTG151290.39761060442120705No Hit
TCACAGTGAACCGGTCTCTTTT151220.39742663494332037No Hit
TTCACCGTGGCTAAGTTCTGC150760.3962176926600646No Hit
TCCAGCATCAGTGATTTTGTTG148310.3897787609340288No Hit
TCTTTGGTTATCTAGCTGTATG143030.37590220603057206No Hit
TTGCATAGTCACAAAAGTGATC139900.36767614223363654No Hit
TGAGATGAAGCACTGTAGCTCT137270.3607641461358919No Hit
TGAGGTAGTAGGTTGTATAGTTT131620.3459151811350339No Hit
TATTGCACTTGTCCCGGCCTGT122020.32068508131056706No Hit
CCTGTCTGAGGGTCGCT121560.3194761390273113No Hit
TAAAGGGAATTTGCGACTGTT117950.30998857023915244No Hit
TTCCCTTTGTCATCCTATGCCT117230.3080963127523174No Hit
CCCTGAGACCCTTAACCTGTGA112620.29598060856577657No Hit
TAAAGCTAGAGAACCGAAAGTC111300.2925114698399124No Hit
AGCTACATTGTCTGCTGGGTTT108930.2862827889457471No Hit
TCCCTGAGACCCTAACTTGTG108840.28604625675989276No Hit
AGCTACATCTGGCTACTGGGTCT107020.2812630503348376No Hit
TACCCTGTAGAACCGAATTTGT104940.2757965287062031No Hit
TTCAAGTAATCCAGGATAGGCTT98020.25760983174939994No Hit
TAAGGCACGCGGTGAATGCC94930.24948889336839966No Hit
TCTTTGGTTATCTAGCTGTATGT94410.24812226296124104No Hit
AACCCGTAGATCCGAACTTGT93660.24615116141245458No Hit
CCCTGCGACCCTTAACCTGTGA93530.24580950381066494No Hit
AGCTACATTGTCTGCTGGGTTTC87910.2310393828717583No Hit
TAAAGCTAGAGAACCGAAAGTAA86730.22793818310166755No Hit
ACCGTGGCTTTAGATTGTTACT84570.22226141064116256No Hit
TGAGATGAAGCACTGTAGCTC83320.2189762413931851No Hit
TGAGGTAGTAGGTTGTGTGGTT83150.21852945837546014No Hit
TGAGGTAGTTGGTTGTATTGTT82490.21679488901252805No Hit
AAGCTGCCAGTTGAAGAGCTGT75010.19713643623263097No Hit
AGAATAATGCCAGCAGTCGGTC75000.19711015487864714No Hit
ACCATCGACCGTTGACTGTGCC74660.19621658884319731No Hit
AACATTCAACGCTGTCGGTGT74660.19621658884319731No Hit
TAAAGCTAGAGAACCGAAAGTAT74140.19484995843603867No Hit
AACATTCAACGCTGTCGGTGAGA73210.19240579251554346No Hit
TCTTTGGTTATCTAGCTGTCTGA72990.19182760272789942No Hit
TTCCCTTTGTCATCCTATGCCTG72250.18988278253309676No Hit
TGAGGTAGTAGATTGAATAGTT71290.1873597725506501No Hit
ACCATCGACCGTTGACTGTGCCT70540.1853886710018636No Hit
AACTCCAGTCACGGTAGCATCTCGTCTGC68280.17944908500152038RNA PCR Primer, Index 24 (96% over 29bp)
CTTTGGTTATCTAGCTGTATGA67990.17868692573598963No Hit
AACCCGTAGATCCGAACTTGTGA67020.1761376343995591No Hit
TCTTTGGTTATCTAGCTGTCT66320.17429793962069173No Hit
CCTTGGCTTTAGACTGCTTACT65650.1725370889037758No Hit
TCCCTGAGACCCTAACTTGTGC65030.17090764495677901No Hit
AGAATCATGCCAGCAGTCGGTC63020.16562509280603127No Hit
AACCCGTAGATCCGAACTTG62510.16428474375285645No Hit
AGCTGGTGTTGTGAATCAGGCCG62190.16344374042537424No Hit
TTCAAGTAATCCAGGATAGGTT61390.16134123210666865No Hit
TGAGGTAGTTGGTTGTATAGT60150.15808234421267503No Hit
TCCCTGAGACCCTAACTTGT60060.15784581202682063No Hit
AACATTCAACGCTGTCGGTGG58880.15474461225672992No Hit
TGAGGTAGTAGTTTGTGCTGTTT58280.15316773101770076No Hit
AACATTCAACGCTGTCGGTG55430.14567754513231218No Hit
TGTGGTCGGCGTCC55050.144678853680927No Hit
TATTGCACTCGTCCCGGCCT53970.1418404674506745No Hit
TAGCTTATCAGACTGGTGTTGG53410.1403687116275806No Hit
CATTGCACTTGTCTCGGTCTGA53110.139580271008066No Hit
TACCCTGTAGATCCGGATTTGT52620.13829248466285884No Hit
TCCCTGAGACCCTTAACCTG51750.13600600686626654No Hit
TCCCTGAGACCCTTAACCTGTGT51630.1356906306184607No Hit
GTACAGTACTGTGATAACTGA51580.1355592238485416No Hit
TGAGGTAGTAGTTTGTATAGT48940.12862094639681323No Hit
TGAGGTAGTAGTTTGTGC48280.12688637703388111No Hit
CACCACGTTCCCGTGG47830.12570371610460926No Hit
TAACGGAACCCATAATGCAGCTG47380.12452105517533738No Hit
TCACAGTGAACCGGTCTCT47220.12410055351159625No Hit
TGAGGTAGTTGTTTGTACAGTT47180.12399542809566097No Hit
AACATTCAACGCTGTCGGTGAT47060.12368005184785515No Hit
CATTATTACTTTTGGTACGCG46890.12323326883013021No Hit
TGAGGTAGTAGGTTGTGTGGTTT46660.12262879768850235No Hit
AGCAGCATTGTACAGGGCTATGA44860.11789815397141483No Hit
CACTCCAGTCACGGTAGCATCTCGTATGC43380.11400851358180951RNA PCR Primer, Index 24 (96% over 29bp)
TTCAAGTAATCAAGGATAGGCT43290.11377198139595514No Hit
CAGGCTGGTTAGATGGTTGTCT41860.11001374777626893No Hit
TATGGCTTTTTATTCCTATCTG41040.10785867674959573No Hit
TCGTGTCTTGTGTTGCAGCCAGT40790.10720164290000023No Hit
TCCAGCATCAGTGATTTTGT40780.10717536154601641No Hit
CTGGACAACTCTTAGCGG40700.10696511071414587No Hit
TACCCTGTAGAACCGAATTTGCG40680.10691254800617822No Hit
TACAGTACTGTGATAACTGAAG38860.10212934158112305No Hit
TGAGGTAGTAGGTTGTATGGTT38810.10199793481120395No Hit
TGCTCAGTAGTCAGTGTAGATCC38650.10157743314746284No Hit
AACATTCAACGATGTCGGTGAG38200.10039477221819096No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGGAG50.0081735381000.379423
CATCTAA50.0081735381000.379423
CTAAGCC50.0081735381000.379423
ACATAGC50.0081735381000.379423
GATCTCG50.0081735381000.379423
CGTATGG102.1733531E-51000.379423
TCTGACG50.0081735381000.379423
CCTCACC50.0081735381000.379423
CACCAAA50.0081735381000.379423
ATTTGCT50.0081735381000.379423
CCTTACA50.0081735381000.379423
TCACTAA102.1733531E-51000.379423
AAAGTTG50.0081735381000.379423
AATAACC201.382432E-101000.379423
TAACTAA155.480615E-81000.3793323
CGTATGC28200.0979.0946723
CGTCTGC13500.0933.6874423
ATCACTA1150.0734.9975622
CGCGGGA105.4804925E-5734.9975622
ATCACCA105.4804925E-5734.9975622