FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_39_JM18_1_ATCACG_L005_R1_001_TRIMMED_prinseq_good__0_H.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_39_JM18_1_ATCACG_L005_R1_001_TRIMMED_prinseq_good__0_H.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3944690
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG3826539.700458084158704No Hit
TTCAAGTAATCCAGGATAGGCT3064507.768671302434411No Hit
AACATTCAACGCTGTCGGTGAGT1997315.063287609419245No Hit
TGAGGTAGTAGGTTGTATAGTT1119112.8370036682223447No Hit
AACTCCAGTCACATCACGATCTCGTATGC1061862.6918718581181285Illumina PCR Primer Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTT861702.1844555592454666No Hit
AACATTCAACGCTGTCGGTGA681001.7263714005409805No Hit
TCCCTGAGACCCTTAACCTGTG458071.1612319345753404No Hit
TAAAGCTAGAGAACCGAAAGTA391190.991687559732197No Hit
TATTGCACTCGTCCCGGCCTCC382080.9685932227881024No Hit
TGAGGTAGTAGGTTGTATAGT376030.9532561494059103No Hit
AACATTCATTGCTGTCGGTGGG318820.8082257414397583No Hit
TAAAGCTAGAGAACCGAAAGT317990.8061216470749286No Hit
TCTTTGGTTATCTAGCTGTATGA311040.7885030255862945No Hit
TCCCTGAGACCCTTAACCTGT309940.7857144667895323No Hit
TCCAGCATCAGTGATTTTGTT308100.7810499684385845No Hit
TGAGGTAGTAGTTTGTGCTGTT305900.7754728508450601No Hit
AGCTACATCTGGCTACTGGGTCTC301510.7643439661925272No Hit
TCCCTGAGACCCTTAACCTGTGA287530.7289039189391308No Hit
TCTTTGGTTATCTAGCTGTAT278250.705378622908264No Hit
AACCCGTAGATCCGAACTTGTG261210.6621813120929655No Hit
CCACGTTCCCGTGG252790.6408361620304763No Hit
TTAAAGGGAATTTGCGACTGTT240610.6099592109899638No Hit
TCACAGTGAACCGGTCTCTT225740.5722629661646416No Hit
ACCTTGGCTTTAGACTGCTTACT215350.5459237608024965No Hit
TGAGGTAGTAGTTTGTATAGTT206640.5238434452390429No Hit
AAGCTGCCAGCTGAAGAACTGT202140.5124357047068338No Hit
TTCACAGTGGCTAAGTTCTGC189800.48115314511406476No Hit
TCCCTGAGACCCTAACTTGTGA188810.47864344219697874No Hit
TTCAAGTAATCCAGGATAGGC183270.4645992460751035No Hit
CCCTGAGACCCTTAACCTGTGA182600.46290076026253013No Hit
TAGCTTATCAGACTGGTGTTGGC182150.46175998620930925No Hit
AACATTCATTGCTGTCGGTGGGT174210.44163166180358915No Hit
TCACAGTGAACCGGTCTCTTTT174070.44127675432036484No Hit
TTCACAGTGGCTAAGTTCTG170170.43139004585911694No Hit
AAGCTGCCAGCTGAAGAACT167010.4233792769520546No Hit
TGAGGTAGTTGGTTGTATAGTT165800.42031186227561607No Hit
AACATTCAACGCTGTCGGTGG159320.40388471590923497No Hit
TCTTTGGTTATCTAGCTGTATG141860.35962268264426356No Hit
TAACAGTCTACAGTCATGGCT135810.3442856092620713No Hit
TTGCATAGTCACAAAAGTGATC135560.3436518458991708No Hit
TACCCTGTAGAACCGAATTTGT129650.3286696800002028No Hit
TGAGATGAAGCACTGTAGCT114610.2905424760881083No Hit
TGAGATGAAGCACTGTAGCTCT111980.283875285510395No Hit
TCCAGCATCAGTGATTTTGTTG111650.2830387178713663No Hit
AACTCCATTCACATCACGATCTCGTATGC110390.2798445505223478Illumina PCR Primer Index 1 (96% over 29bp)
TAAAGGGAATTTGCGACTGTT108580.2752561037749481No Hit
AACTCCAGTCACATCACGATCTCGTCTGC107990.2737604222385029Illumina PCR Primer Index 1 (96% over 29bp)
TATTGCACTTGTCCCGGCCTGT107180.27170702894270526No Hit
ACCGTGGCTTTAGATTGTTACT102810.2606288453592044No Hit
AACATTCGGCGCTGTCGGTGAG101200.2565474093021251No Hit
AGCTACATCTGGCTACTGGGTCT98420.2494999607066715No Hit
TACCCTGTAGATCCGGATTTGT95470.24202155302444553No Hit
AGAATAATGCCAGCAGTCGGTC91180.23114617371707286No Hit
TTCCCTTTGTCATCCTATGCCT90450.22929558469740335No Hit
TAAAGCTAGAGAACCGAAAGTAA89790.22762244941934598No Hit
TTCAAGTAATCCAGGATAGGCTT89080.22582256146870855No Hit
TCCCTGAGACCCTTAACCTGTGG87340.22141156846292107No Hit
TCTTTGGTTATCTAGCTGTATGT86510.21930747409809134No Hit
TGAGGTAGTTGGTTGTATTGTT85800.2175075861474539No Hit
AGCTACATTGTCTGCTGGGTTT85010.21550489392068833No Hit
CCTGTCTGAGGGTCGCT83920.2127416856584421No Hit
TCCCTGAGACCCTAACTTGTG83130.21073899343167649No Hit
CCTTGGCTTTAGACTGCTTACT82640.2094968172403915No Hit
ACCATCGACCGTTGACTGTGCC81180.20579563920105257No Hit
TGAGGTAGTAGGTTGTGTGGTT80850.2049590715620239No Hit
AAGCTGCCAGTTGAAGAGCTGT80710.2046041640787996No Hit
TGAGGTAGTAGGTTGTATAGTTT80490.20404645231944718No Hit
AACATTCAACGCTGTCGGTGAGA80480.20402110178493116No Hit
TTCCCTTTGTCATCCTATGCCTG78990.20024387214204412No Hit
TTCAAGTGGTCCAGGATAGGCT78210.19826653044979453No Hit
TAAGGCACGCGGTGAATGCC74780.1895712971107996No Hit
TTCAAGTAATCCAGGATAGGTT72870.1847293450182397No Hit
TTCACCGTGGCTAAGTTCTGC72850.18467864394920766No Hit
TAAAGCTAGAGAACCGAAAGTAT71320.18080001216825656No Hit
CTTTGGTTATCTAGCTGTATGA67260.17050769515475234No Hit
ACCATCGACCGTTGACTGTGCCT67250.17048234462023631No Hit
AACCCGTAGATCCGAACTTGT67220.17040629301668828No Hit
TTCACCGTGGCTAAGTTCTG66370.16825149758282654No Hit
TGAGATGAAGCACTGTAGCTC65340.16564039252767643No Hit
AGCTACATTGTCTGCTGGGTTTC62580.15864364500125486No Hit
TACCCTGTAGAACCGAATGTGT62110.1574521698790019No Hit
AGCTGGTGTTGTGAATCAGGCCG61730.15648884956739315No Hit
AACATTCAACGCTGTCGGTGT59980.15205250602708958No Hit
TACCCTGTAGAACCGAATTTGCG58620.14860483333291083No Hit
TACGACCTCAGATCAGACGAGA58600.14855413226387879No Hit
TGAGGTAGTTGGTTGTATAGT57990.14700774965840155No Hit
TGAGGTAGTAGTTTGTGCTGTTT56700.14373753070583492No Hit
AACATTCAACGCTGTCGGTG56580.14343332429164268No Hit
CCCTGCGACCCTTAACCTGTGA55490.14067011602939647No Hit
CCCTGAGACCCTTAACCTGTGG53510.13565071019522446No Hit
AACATTCAGCGCTGTCGGTGAG53120.13466203934909968No Hit
TCCCTGAGACCCTAACTTGTGG51550.13068200543008449No Hit
TGTAAACATCCTTGACTGGAAGCT51200.12979473672202377No Hit
CATTGCACTTGTCTCGGTCTGA50970.12921167442815532No Hit
CACCACGTTCCCGTGG50840.12888211747944706No Hit
AGCAGCATTGTACAGGGCTATGA50530.12809625090945043No Hit
TACCCTGTAGAACCGAATTTGC50440.12786809609880626No Hit
TCACAGTGAACCGGTCTCT50160.12715828113235766No Hit
TGTGGTCGGCGTCC50090.12698082739074554No Hit
AACATTCGGCGCTGTCGGTGAGT50060.12690477578719747No Hit
AACCCGTAGATCCGAACTTG50020.12680337364913338No Hit
TCCCTGAGACCCTAACTTGT49880.1264484661659091No Hit
TAGCAGCACGTAAATATTGGAG49560.12563724906139645No Hit
TAACAGTCTACAGCCATGGTCG49510.12551049638881637No Hit
TAACGGAACCCATAATGCAGCTG48330.12251913331592598No Hit
TGCTCAGTAGTCAGTGTAGATCC48280.12239238064334587No Hit
TGAGGTAGTAGGTTGTATGGTT46550.11800673817207435No Hit
TGAGGTAGTAGATTGAATAGTT46520.1179306865685263No Hit
ACCATCGACCGTTGACTGTACC46020.11666315984272528No Hit
AACATTCGACGCTGTCGGTGAG45360.11499002456466793No Hit
TCCCTGAGACCCTTAACCTG44510.11283522913080624No Hit
TGAGGTAGTTGTTTGTACAGTT43820.11108604224920081No Hit
TTCAAGTAATCCAGGATAGGCG43220.1095650101782396No Hit
TTCAAGTAGTCCAGGATAGGCT42980.10895659734985513No Hit
TGAGGTAGTAGTTTGTGC42590.10796792650373034No Hit
GTACAGTACTGTGATAACTGA42310.10725811153728176No Hit
AACATTCAACGCTGTCGGTGAA42040.10657364710534921No Hit
TAGCAGCACGGAATGGTTTGT41310.10472305808567975No Hit
TGAGGTAGTAGTTTGTGCTGT41150.10431744953342341No Hit
TGCTCAGTAGTCAGTGTAGATC40600.1029231701350423No Hit
TTCAAGTAATCCAGGATAGGCA40530.10274571639343015No Hit
AACATTCAACGCTGTCGGTGAT40360.10231475730665782No Hit
TATTGCACTCGTCCCGGCCT40060.1015542412711772No Hit
TGTAAACATCCCCGACTGGA39760.1007937252356966No Hit
TCGTGTCTTGTGTTGCAGCCAGT39670.1005655704250524No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGG700.0358.822323
CGTATGA251.6370905E-10358.822323
CGCATGC1300.0358.822323
CAACCCG104.704733E-4358.822323
TATTCCG251.6370905E-10358.822323
TAACTAA104.704733E-4358.822323
CGTATGC134000.0354.2700823
CGTCTGC18600.0340.4953623
CGAATGC650.0331.2205823
GGAATAA154.601299E-6330.365322
TCGCATG1150.0330.3652622
TACTTCC106.026473E-4330.3652622
TACTAAC106.026473E-4330.3652622
GCGTATG106.026473E-4330.3652622
CGGATGC4400.0326.202123
TCGTATG135500.0325.0014322
GATACCA204.6087735E-8312.787421
CACGGAT107.099145E-4312.787421
TTACTTC107.099145E-4312.787421
CTCGCAT1150.0312.787421