FastQCFastQC Report
Tue 7 Jun 2016
nfu_brain_mzm_39_JM1_1_CGTACG_L001_R1_001_TRIMMED_prinseq_good_uDog.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_39_JM1_1_CGTACG_L001_R1_001_TRIMMED_prinseq_good_uDog.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2439413
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG2062768.455968710505356No Hit
TTCAAGTAATCCAGGATAGGCT1390065.698338083793109No Hit
AACATTCAACGCTGTCGGTGAGT1112134.559006613476275No Hit
TGAGGTAGTAGGTTGTATAGTT992874.070118508018117No Hit
AACATTCAACGCTGTCGGTGA414331.6984823808022669No Hit
TCACAGTGAACCGGTCTCTTT366591.5027795621323654No Hit
TGAGGTAGTAGGTTGTATAGT249921.0245087650184697No Hit
TCCCTGAGACCCTTAACCTGTG248221.0175398753716571No Hit
TATTGCACTCGTCCCGGCCTCC225960.926288414466923No Hit
TCCCTGAGACCCTTAACCTGT207970.8525411646162417No Hit
TTCAAGTAATCAAGGATAGGCT206220.8453673076268758No Hit
TCCAGCATCAGTGATTTTGTT205650.8430306799217681No Hit
TACCCTGTAGAACCGAATTTGT201710.8268792533285672No Hit
TAAAGCTAGAGAACCGAAAGTA196220.8043738391162135No Hit
TGAGGTAGTAGTTTGTGCTGTT194870.7988397208672742No Hit
AACTCCAGTCACCGTACGATCTCGTATGC189880.7783839800804538TruSeq Adapter, Index 22 (96% over 29bp)
AGCTACATCTGGCTACTGGGTCTC183210.7510413365838421No Hit
TAAAGCTAGAGAACCGAAAGT182450.7479258329770317No Hit
TGAGGTAGTAGTTTGTATAGTT182160.7467370223902225No Hit
AACCCGTAGATCCGAACTTGTG170370.6984057230161519No Hit
AACATTCATTGCTGTCGGTGGG165710.6793027666901832No Hit
CCACGTTCCCGTGG162390.6656929351446434No Hit
AACATTCNACGCTGTCGGTGAG160800.6591749736514482No Hit
TTAAAGGGAATTTGCGACTGTT141900.5816973181662966No Hit
TCCCTGAGACCCTTAACCTGTGA134050.5495174453854268No Hit
TCTTTGGTTATCTAGCTGTAT132720.5440653140735087No Hit
TTCACAGTGGCTAAGTTCTGC125580.5147959775568959No Hit
TAACAGTCTACAGTCATGGCT118260.4847887586070911No Hit
TCTTTGGTTATCTAGCTGTATGA115790.47466337188495755No Hit
TACCCTGTAGATCCGGATTTGT114490.46933422097857147No Hit
TTCAAGTNATCCAGGATAGGCT114450.46917024710452887No Hit
TGAGGTAGTTGGTTGTATAGTT113720.4661777239032505No Hit
TTCACAGTGGCTAAGTTCTG108330.4440822443760035No Hit
ACCTTGGCTTTAGACTGCTTACT100000.40993468510662195No Hit
TCACAGTGAACCGGTCTCTT98350.4031707628023627No Hit
AAGCTGCCAGCTGAAGAACTGT97660.40034221347512705No Hit
AACATTCATTGCTGTCGGTGGGT97520.3997683049159777No Hit
TCTTTGGTTATCTAGCTGTCT96910.3972677033368273No Hit
TAGCTTATCAGACTGGTGTTGGC93420.38296098282660623No Hit
AAGCTGCCAGCTGAAGAACT93200.3820591265193717No Hit
TTCAAGTAATCCAGGATAGGC92170.37783679926277347No Hit
TCTTTGGTTATCTAGCTGTCTGA87780.35984066658659275No Hit
TTGCATAGTCACAAAAGTGATC87560.3589388102793582No Hit
AACATTCNACGCTGTCGGTGAGT86080.35287177693978017No Hit
TACCCTGTAGAACCGAATGTGT84850.34782958031296873No Hit
AACATTCAACGATGTCGGTGAG84270.34545195913935034No Hit
CCCTGAGACCCTTAACCTGTGA83020.3403277755755176No Hit
AACTCCAGTCACCGTACGATCTCGTCTGC82900.3398358539533896RNA PCR Primer, Index 22 (96% over 29bp)
TGAGGTANTAGGTTGTATAGTT82280.33729425890572856No Hit
TCCCTGAGACCCTAACTTGTGA79100.32425833591933795No Hit
TCCAGCATCAGTGATTTTGTTG77420.31737143320954675No Hit
TCACAGTGAACCGGTCTCTTTT76460.31343606023252313No Hit
TACCCTGTAGAACCGAATTTGCG75230.3083938636057117No Hit
TGAGGTAGTAGGTTGTATAGTTT74000.30335166697890026No Hit
TAAAGCTAGAGAACCGAAAGTC73710.30216285639209106No Hit
TATTGCACTTGTCCCGGCCTGT70100.287364214259742No Hit
TACCCTGTAGAACCGAATTTGC68440.2805592984869721No Hit
TAAAGGGAATTTGCGACTGTT68000.27875558587250293No Hit
TTCCCTTTGTCATCCTATGCCT67250.27568107573420325No Hit
TTGCATAGTCACAAAAGTGCTC66770.2737133892456915No Hit
CCTGTCTGAGGGTCGCT66750.27363140230867017No Hit
TGAGATGAAGCACTGTAGCT64120.262850120090366No Hit
TGAGATGAAGCACTGTAGCTCT63810.2615793225665355No Hit
AGCTACATTGTCTGCTGGGTTT62940.2580128908061079No Hit
AGCTACATCTGGCTACTGGGTCT61830.2534626158014244No Hit
TCTTTGGTTATCTAGCTGTATG59880.24546888944184525No Hit
CACTCCAGTCACCGTACGATCTCGTATGC57210.23452363334949844RNA PCR Primer, Index 22 (96% over 29bp)
TCACAGTGAACAGGTCTCTTT54880.22497215518651414No Hit
ACCATCGACCGTTGACTGTGCC51970.2130430558499114No Hit
TAAGGCACGCGGTGAATGCC51790.21230517341671953No Hit
AACATTCAACGCTGTCGGTGG51060.20931265021544115No Hit
TGAGGTAGTTGGTTGTATTGTT49340.20226177363160727No Hit
AAGCTGCCAGTTGAAGAGCTGT48080.19709659659926382No Hit
TGAGGTAGTAGGTTGTGTGGTT47760.19578480560692263No Hit
AGCTACATTGTCTGCTGGGTTTC47740.19570281866990136No Hit
AACATTCAACGATGTCGGTGAGT47450.19451400808309213No Hit
AACCCGTAGATCCGAACTTGT47360.19414506686649616No Hit
TGTGGTCGGCGTCC47360.19414506686649616No Hit
AGAATAATGCCAGCAGTCGGTC47140.1932432105592616No Hit
TCCCTGAGACCCTAACTTGTG46860.19209539344096305No Hit
TTCAAGTAATCCAGGATAGGCTT42670.17491913013499558No Hit
TTCCCTTTGTCATCCTATGCCTG42580.17455018891839963No Hit
TCTTTGGTTATCTAGCTGTCTG42460.1740582672962717No Hit
AGCTGGTGTTGTGAATCAGGCCG42180.17291045017797316No Hit
GTACAGTACTGTGATAACTGA41190.16885209679541757No Hit
AACATTCAACGCTGTCGGTGAGA40180.1647117564758407No Hit
TGAGATGAAGCACTGTAGCTC38680.15856273619924138No Hit
CTTTGGTTATCTAGCTGTATGA38210.15663604317924026No Hit
TAAAGCTAGAGAACCGAAAGTAA38090.1561441215571123No Hit
TGAGGTAGTAGATTGAATAGTT37150.15229073551711006No Hit
TTCACCGTGGCTAAGTTCTGC37120.15216775511157807No Hit
AACATTCAACGCTGTCGGTGT37000.15167583348945013No Hit
ACCATCGACCGTTGACTGTGCCT35970.14745350623285192No Hit
TACCCTGTAGATCCGGATTTGTG35870.1470435715477453No Hit
TCCCTGAGACCCTAACTTGT35480.14544482627582947No Hit
CACTCCAGTCACCGTACGATCTCGTCTGC35360.14495290465370153RNA PCR Primer, Index 22 (96% over 25bp)
TGAGGTAGTTGGTTGTATAGT34940.14323117897625373No Hit
CTGGACAACTCTTAGCGG34810.1426982638856151No Hit
TTCAAGTAATCCAGGATAGGTT34730.1423703161375298No Hit
TCTTTGGTTATCTAGCTGTATGT34270.14048461658603936No Hit
TCCCTGAGACCCTAACTTGTGC34270.14048461658603936No Hit
ACCGTGGCTTTAGATTGTTACT33630.13786103460135699No Hit
AACATTCNACGCTGTCGGTGA33520.13741010644773968No Hit
TTCACCGTGGCTAAGTTCTG33460.13716414563667573No Hit
TAAAGCTAGAGAACCGAAAGTAT33230.13622129586093049No Hit
AACATTCAACGCTGTCGGTG32790.13441758324646136No Hit
AACTCCATTCACCGTACGATCTCGTATGC32270.1322859228839069RNA PCR Primer, Index 22 (96% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTT31680.12986730824177783No Hit
CCCTGAGACCCTTAACCTGTGC31280.12822756950135136No Hit
TGAGGTAGTAGTTTGTATAGT30510.12507107242603036No Hit
TCACAGTNAACCGGTCTCTTT29110.11933198683453765No Hit
CCTTGGCTTTAGACTGCTTACT28310.11605250935368468No Hit
TGAGGTAGTAGTTTGTGC26710.10949355439197872No Hit
AACCCGTAGATACGAACTTGTG26660.10928858704942541No Hit
TCCCTGAGACCCTTAACCTG26530.1087556719587868No Hit
AACCCGTAGATCCGAACTTG26520.10871467849027615No Hit
CATTGCACTTGTCTCGGTCTGA26420.10830474380516951No Hit
CATTATTACTTTTGGTACGCG26410.10826375033665886No Hit
AACCCGTAGATCCGAACTTGTGA26310.10785381565155223No Hit
TGAGGTAGTAGGTTGTGTGGTTT26170.10727990709240295No Hit
CAGGCTGGTTAGATGGTTGTCT26160.10723891362389232No Hit
TAGCTTATCAGACTGGTGTTGG26150.10719792015538164No Hit
TGAGGTAGTTGTTTGTACAGTT26130.10711593321836033No Hit
TATGGCTTTTTATTCCTATCTG25920.10625507037963641No Hit
TCGTGTCTTGTGTTGCAGCCAGT25570.10482029898176325No Hit
TCTTTGGTTATCTAGCTGTCTGT25530.10465632510772058No Hit
TAACAGTCTACAGCCATGGTCG25410.10416440348559265No Hit
ACCGTGGCTTTAGATTGTTCCT25280.10363148839495404No Hit
TATTGCACTCGTCCCGGCCT24940.1022377104655915No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACCCG101.3067696E-4549.9721723
GCGGACA101.3067696E-4549.9721723
CGTATTC202.741217E-9549.9721723
CGTCTAC155.9914055E-7549.9721723
CGTATAC251.2732926E-11549.972123
CGTCTGC21300.0538.35323
CGTATGC33950.0537.822623
GTATGCC650.0465.3610523
ATAACAC151.2217006E-6460.222122
ATAAACA206.681148E-9460.2220822
TCGTATT206.681148E-9460.2220822
ATCAACA102.2296865E-4460.2220822
ACAACCC500.0460.2220822
TCGTATG34350.0447.4939622
TCGTCTG21550.0446.340722
TAACTAA258.354618E-9439.977723
ATCACTA900.0434.654222
ATCACTG800.0431.458222
ATAACTA1900.0411.7776522
TAATAAC400.0402.694322