FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_5_JM101_1_ATCACG_L001_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_5_JM101_1_ATCACG_L001_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences1830792
Sequences flagged as poor quality0
Sequence length8-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG19904410.872016045514728No Hit
AACATTCAACGCTGTCGGTGAGT1140736.230800658949788No Hit
AACTCCAGTCACATCACGATCTCGTATGC514702.8113515899129995Illumina PCR Primer Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCT509212.781364567902853No Hit
AACCCGTAGATCCGAACTTGTG427252.3336894633579344No Hit
TCACAGTGAACCGGTCTCTTT336341.8371284121844536No Hit
TGAGGTAGTAGGTTGTATAGTT301551.6471013637813579No Hit
TAAAGCTAGAGAACCGAAAGTA274831.5011535990980953No Hit
TCCCTGAGACCCTTAACCTGT230791.2606019689839152No Hit
AACATTCAACGCTGTCGGTGA229731.2548121250256719No Hit
TATTGCACTCGTCCCGGCCTCC222481.2152117771980653No Hit
AACTCCAGTCACATCACGATCTCGTCTGC220741.2057076937194395Illumina PCR Primer Index 1 (96% over 29bp)
AACATTCAACGATGTCGGTGAG194201.0607431100856897No Hit
CCACGTTCCCGTGG192451.0511844054376467No Hit
AGCTACATCTGGCTACTGGGTCTC186971.0212520045969176No Hit
TCCCTGAGACCCTTAACCTGTG178480.9748786317615545No Hit
CCTGTCTGAGGGTCGCT158570.8661278834515335No Hit
TAAAGCTAGAGAACCGAAAGT156740.8561322094481514No Hit
CACTCCAGTCACATCACGATCTCGTATGC152560.8333005606316829Illumina PCR Primer Index 1 (96% over 29bp)
AACATTCATTGCTGTCGGTGGG141490.7728349260866335No Hit
TCCCTGAGACCCTTAACCTGTGA140720.7686290960414947No Hit
TAGCTTATCAGACTGGTGTTGGC122080.666815236247482No Hit
TTAAAGGGAATTTGCGACTGTT120780.6597144842232214No Hit
TAAAGCTAGAGAACCGAAAGTC109920.6003958942359372No Hit
TATTGCACTTGTCCCGGCCTGT104800.5724298554942342No Hit
AACATTCAACGATGTCGGTGAGT102000.5571359280573653No Hit
TGAGGTAGTAGTTTGTATAGTT98630.5387285939637053No Hit
TACCCTGTAGAACCGAATTTGT96110.5249640592705234No Hit
TGAGGTAGTAGTTTGTGCTGTT94720.5173717167215064No Hit
CACTCCAGTCACATCACGATCTCGTCTGC94590.5166616415190802Illumina PCR Primer Index 1 (96% over 25bp)
AACCCGTAGATCCGAACTTGT88810.48509060559582956No Hit
AACTCCATTCACATCACGATCTCGTATGC87950.48039318502593414Illumina PCR Primer Index 1 (96% over 29bp)
AACATTCATTGCTGTCGGTGGGT87130.4759142491337082No Hit
TTCAAGTAATCAAGGATAGGCT82790.4522086616065615No Hit
ACCTTGGCTTTAGACTGCTTACT80700.44079283719832724No Hit
CCCTGAGACCCTTAACCTGTGA75800.4140284641838068No Hit
AAGCTGCCAGCTGAAGAACTGT74950.4093856647833288No Hit
TACCCTGTAGATCCGGATTTGT71800.39217999641685125No Hit
AGCTGGTGTTGTGAATCAGGCCG70000.3823481859217213No Hit
TCTTTGGTTATCTAGCTGTATGA69780.38114652019453876No Hit
TGAGATGAAGCACTGTAGCTC61250.33455466268150613No Hit
ACCATCGACCGTTGACTGTGCC60810.332151331227141No Hit
AACTCCATTCACATCACGATCTCGTCTGC60650.3312773925164628Illumina PCR Primer Index 1 (96% over 25bp)
TGAGGTAGTTGGTTGTATAGTT60180.3287101975538455No Hit
AACCCGTAGATACGAACTTGTG57260.312760816083968No Hit
TAAAGGGAATTTGCGACTGTT56390.30800877434465523No Hit
TCTTTGGTTATCTAGCTGTCTGA53440.2918955293665255No Hit
TTCCCTTTGTCATCCTATGCCTG53280.2910215906558473No Hit
TCCCTGAGACCCTAACTTGTGA53260.29091234831701257No Hit
TTCACAGTGGCTAAGTTCTGC52880.28883674387915176No Hit
TACCCTGTAGAACCGAATTTGCG52860.288727501540317No Hit
AACATTCNACGCTGTCGGTGAG51430.2809166743136304No Hit
TCACAGTGAACCGGTCTCTT49780.27190418135976124No Hit
TCACAGTGAACCGGTCTCTTTT48370.2642025964719094No Hit
TCACAGTGAACAGGTCTCTTT47450.25917744888550964No Hit
AAGGTCCAACCTCACATGTCCT47390.25884972186900534No Hit
TCTTTGGTTATCTAGCTGTAT46890.2561186633981359No Hit
AAGCTGCCAGCTGAAGAACT43190.23590883071370203No Hit
TCTTTGGTTATCTAGCTGTATG43000.23487102849477165No Hit
CACTCCATTCACATCACGATCTCGTATGC42720.23334163575108477Illumina PCR Primer Index 1 (100% over 21bp)
TACCCTGTAGAACCGAATGTGT41120.2246022486443026No Hit
TCCCTGAGACCCTAACTTGT39940.2181569506530507No Hit
AACTCCAGTCACATCACTATCTCGTCTGC39920.2180477083142159Illumina PCR Primer Index 1 (96% over 25bp)
TTGCATAGTCACAAAAGTGATC39350.21493430165742478No Hit
TATGGCTTTTTATTCCTATCTG37930.20717809560015557No Hit
TACCCTGTAGATCCGGATTTGTG37260.20351847724919053No Hit
TCCCTGAGACCCTAACTTGTG37200.20319075023268618No Hit
TAACAGTCTACAGTCATGGCT36810.201060524625408No Hit
TACCCTGTAGAACCGAATTTGC35470.19374128792347792No Hit
TGAGGTAGTAGGTTGTATAGT35440.19357742441522577No Hit
TCCCTGAGACCCTTAACCTG35300.19281272804338231No Hit
TGTCTGAGGGTCGCT35220.1923757586880432No Hit
TCTTTGGTTATCTAGCTGTCT35060.19150181997736498No Hit
CACTCCATTCACATCACGATCTCGTCTGC34940.1908463659443563Illumina PCR Primer Index 1 (95% over 21bp)
TTCACAGTGGCTAAGTTCTG33600.18352712924242623No Hit
AACTCCAGTCACATCACTATCTCGTATGC32450.1772456947594265Illumina PCR Primer Index 1 (96% over 29bp)
TGAGATGAAGCACTGTAGCT32220.17598940786282657No Hit
TCCCTGAGACCCTTAACCTGTGT32180.17577092318515702No Hit
TTGCATAGTCACAAAAGTGCTC31660.1729306223754528No Hit
CCCTGAGACCCTTAACCTGTGC31380.17140122963176593No Hit
TCTTTGGTTATCTAGCTGTCTG31370.17134660846234853No Hit
AACATTCAACGCTGTCGGTGG31200.17041804858225293No Hit
TGAGATGAAGCACTGTAGCTCT31050.1695987310409921No Hit
AACCCGTAGATCCGAACTTGTGA31050.1695987310409921No Hit
ACCATCGACCGTTGACTGTGCCT30970.169161761685653No Hit
AACATTCNACGCTGTCGGTGAGT30860.16856092882206172No Hit
TCCAGCATCAGTGATTTTGTT30270.16533827982643579No Hit
CAGGCTGGTTAGATGGTTGTCT29850.16304419071090542No Hit
AGAATAATGCCAGCAGTCGGTC29720.1623341155084794No Hit
AGCTACATTGTCTGCTGGGTTTC29670.16206100966139245No Hit
TCCAGCATCAGTGATTTTGTTG28970.15823752780217523No Hit
CTGTCTGAGGGTCGCT28740.15698124090557528No Hit
AGCTACATCTGGCTACTGGGTCT28510.15572495400897535No Hit
GGAATACCAGGTGCTGTAAGCTT28220.15414094009587107No Hit
TGAGGTAGTTGGTTGTATTGTT27910.15244768384393204No Hit
TGTAAACATCCTACACTCTCAGCT27610.15080904876141035No Hit
CACCACGTTCCCGTGG26480.14463685661724543No Hit
CTACGCCTGTCTGAGGGTCGCT25840.14114110177453257No Hit
TTCCCTTTGTCATCCTATGCCT24660.1346958037832807No Hit
AGCTACATTGTCTGCTGGGTTT24370.1331117898701764No Hit
AACTCCAGTCACATCACGATCTCG24340.13294792636192426Illumina PCR Primer Index 1 (100% over 24bp)
GAATACCAGGTGCTGTAAGCTT24240.13240171466775036No Hit
TGTAAACATCCTTGACTGGAAGCT24220.13229247232891556No Hit
TCCCTGAGACCCTTAACCTGTGG24180.132073987651246No Hit
TCCCTGAGACCCTAACTTGTGC24140.13185550297357645No Hit
AACATTCAACGATGTCGGTGA24110.1316916394653243No Hit
ACCATCGACCGTTGACTGTACC23630.12906982333328965No Hit
TATGGCTTTTTATTCCTATCTGA23450.12808664228377664No Hit
ACCACGTTCCCGTGG23410.1278681576061071No Hit
TCCCTGAGACCATTAACCTGT23210.1267757342177593No Hit
TAAAGCTAGAGAACCGAAAGTAT23130.1263387648624202No Hit
TAAAGCTAGAGAACCGAAAGTAA22980.12551944732115936No Hit
AACATTCATTGCTGTCGGTGGGTT22360.12213293481728126No Hit
AACATTCAACGCTGTCGGTGAGTT22350.12207831364786387No Hit
AACCCGTAGATCCGAACTTG22300.12180520780077694No Hit
TAGCTTATCAGACTGGTGTTGG22130.12087664792068131No Hit
TATTGCACTCGTCCCGGCCTC21850.11934725517699443No Hit
CACTCCAGTCACATCACTATCTCGTCTGC21770.11891028582165532No Hit
CCCTGCGACCCTTAACCTGTGA21180.11568763682602938No Hit
TTCAAGTAATCCAGGATAGGC21050.11497756162360334No Hit
AACTCCAGTCACATCACGATCTC20930.11432210759059468Illumina PCR Primer Index 1 (100% over 23bp)
CTTTGGTTATCTAGCTGTATGA18750.10241469265760393No Hit
ACCGTGGCTTTAGATTGTTACT18320.10006598237265621No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC100.0034331616184.7466923
CGTATAC100.0034331616184.7466923
CGTCTAC100.0034331616184.7466923
CGTGTGC301.200533E-10184.7466623
CGTCTGC55350.0184.5797923
CGTATGC93800.0182.2847123
TCGTGTG100.003987599175.7319222
CCGTATG100.003987599175.7319222
TCGTCTA100.003987599175.7319222
TCGTCTG55650.0174.4688122
TCGTATG94350.0172.5655822
GATAACA157.2419585E-5165.5590221
GATAAAA157.2419585E-5165.5590221
CCCGTAT100.0047665047165.5590221
GATCACA100.0047665047165.5590221
CGCGTGT157.2419585E-5165.5590221
CTCGTCT56650.0164.6822721
GTATGCC1200.0161.6533423
CTCGTAT98600.0160.5217321
CGACAAC201.3872886E-6157.9826820