FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_5_JM103_1_CGATGT_L002_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_5_JM103_1_CGATGT_L002_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3886465
Sequences flagged as poor quality0
Sequence length8-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG43494111.19117244076558No Hit
AACTCCAGTCACCGATGTATCTCGTATGC2215655.700939028139969Illumina PCR Primer Index 2 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGT2053545.283824761061787No Hit
TTCAAGTAATCCAGGATAGGCT1265343.25576069770344No Hit
AACCCGTAGATCCGAACTTGTG1049572.7005775171010162No Hit
AACTCCAGTCCCCGATGTATCTCGTATGC885062.2772879724891384Illumina PCR Primer Index 2 (96% over 29bp)
TAAAGCTAGAGAACCGAAAGTA773811.9910381284792222No Hit
TGAGGTAGTAGGTTGTATAGTT732871.885698185883573No Hit
CCACGTTCCCGTGG703701.8106428335260962No Hit
TCACAGTGAACCGGTCTCTTT678461.7456994981300489No Hit
TCCCTGAGACCCTTAACCTGTG494631.27269896937191No Hit
TCTTTGGTTATCTAGCTGTATGA406291.0453972954857436No Hit
TCTTTGGTTATCTAGCTGTATG369190.9499377969440096No Hit
AACATTCAACGCTGTCGGTGA355270.9141211872485665No Hit
TCTTTGGTTATCTAGCTGTAT350000.90056130699749No Hit
TAAAGCTAGAGAACCGAAAGT342770.8819582834272276No Hit
TGAGGTAGTAGTTTGTGCTGTT322230.8291081998680035No Hit
AGCTACATCTGGCTACTGGGTCTC313970.8078549530228627No Hit
TATTGCACTTGTCCCGGCCTGT313250.8060023697627535No Hit
TCCCTGAGACCCTTAACCTGTGA269210.6926860270194122No Hit
TCCCTGAGACCCTTAACCTGT264400.6803097416289611No Hit
AACATTCATTGCTGTCGGTGGG253410.6520321165892399No Hit
TGAGGTAGTAGTTTGTATAGTT241880.6223650541044368No Hit
AACCCGTAGATCCGAACTTGT220100.5663244104861359No Hit
TAGCTTATCAGACTGGTGTTGGC218630.5625420529967464No Hit
AACTCCAGTCCCCGCTGTATCTCGTATGC212570.5469494772241613No Hit
TTAAAGGGAATTTGCGACTGTT211160.5433215016731142No Hit
TGAGGTAGTTGGTTGTATAGTT210620.5419320642280324No Hit
AGCTACATTGTCTGCTGGGTTTC209490.5390245377225834No Hit
TTGCATAGTCACAAAAGTGATC204520.5262365671632191No Hit
TCCCTGAGACCCTAACTTGTGA199200.5125480352968572No Hit
AACTCCAGTCACCGCTGTATCTCGTATGC194810.5012524234748029Illumina PCR Primer Index 2 (96% over 29bp)
TATTGCACTCGTCCCGGCCTCC190600.490419957467776No Hit
AAGGTCCAACCTCACATGTCCT178700.4598008730298613No Hit
ACCTTGGCTTTAGACTGCTTACT177450.45658458264772744No Hit
CCTGTCTGAGGGTCGCT176270.453548404526993No Hit
TACCCTGTAGAACCGAATTTGT168470.43347875254247753No Hit
CACCACGTTCCCGTGG164790.4240099936574753No Hit
AACATTCATTGCTGTCGGTGGGT162590.4183493225849197No Hit
TCACAGTGAACCGGTCTCTTTT153220.39424000988044405No Hit
AGCTACATTGTCTGCTGGGTTT152030.3911781014366526No Hit
AGCTGGTGTTGTGAATCAGGCCG135640.349006101946113No Hit
TGAGGTAGTTGGTTGTATTGTT130180.33495734555695217No Hit
GGAATACCAGGTGCTGTAAGCTT113380.2917304028210726No Hit
TCCACCACGTTCCCGTGG113220.2913187176521595No Hit
AGCTACATCTGGCTACTGGGTCT108900.2802032180915048No Hit
TGAGGTAGTAGGTTGTATAGT105830.27230400891298395No Hit
TACCCTGTAGATCCGGATTTGT103150.26540828233368885No Hit
TCTTTGGTTATCTAGCTGTATGT101080.2600821054608751No Hit
AAGCTGCCAGCTGAAGAACTGT99340.25560502924894474No Hit
TCCCTGAGACCCTAACTTGTG99230.255321995695317No Hit
TACCCTGTAGAACCGAATTTGCG97320.25040750399141637No Hit
TAAAGGGAATTTGCGACTGTT93380.24026975670693035No Hit
TAACAGTCTACAGTCATGGCT91020.23419740046546153No Hit
CCCTGAGACCCTTAACCTGTGA90160.23198459268255345No Hit
ACCACGTTCCCGTGG88570.22789347131647908No Hit
TGAGATGAAGCACTGTAGCTC87620.22544909062605736No Hit
ACCATCGACCGTTGACTGTACC86600.22282459767423607No Hit
TCACAGTGAACCGGTCTCTT86000.22128077829081183No Hit
AGCAGCATTGTACAGGGCTATGA83110.21384471492731827No Hit
CTTTGGTTATCTAGCTGTATGA83010.21358741169674755No Hit
TTCACAGTGGCTAAGTTCTGC82630.21260965942057883No Hit
CTGGACAACTCTTAGCGG79150.2036555069967181No Hit
ACCATCGACCGTTGACTGTGCC76900.19786618430887706No Hit
GGAATCCCAGGTGCTGTAAGCTT76510.1968627017096513No Hit
TGTAAACATCCTTGACTGGAAGCT74830.19254000743606337No Hit
CAGGCTGGTTAGATGGTTGTCT74100.19066169385289716No Hit
AACCCGTAGATCCGAACTTGTGA73610.1894009080231007No Hit
TAAAGCTAGAGAACCGAAAGTAT73520.18916933511558706No Hit
TCCAGCATCAGTGATTTTGTTG73180.18829450413164664No Hit
TACCCTGTAGAACCGAATGTGT73080.1880372009010759No Hit
AACTCCAGTCACCGATGGATCTCGTATGC72670.186982257655736Illumina PCR Primer Index 2 (96% over 29bp)
CCACCACGTTCCCGTGG71580.18417765244251524No Hit
CTTTTTGCGGTCTGGGCTTGC71140.1830455182280041No Hit
CATTGCACTTGTCTCGGTCTGA69600.17908304847721518No Hit
TTCCCTTTGTCATCCTATGCCT68960.1774363078015626No Hit
TACCCTGTAGAACCGAATTTGC68870.17720473489404898No Hit
TCTTTGGTTATCTAGCTGTA68060.1751205787264262No Hit
TCCAGCATCAGTGATTTTGTT67370.17334518643548827No Hit
TATGGCTTTTTATTCCTATCTG66770.17180136705206403No Hit
AACTCCAGTCACCGATGTATCT65460.1684306947315877Illumina PCR Primer Index 2 (100% over 22bp)
AACTCCAGTAACCGATGTATCTCGTATGC65340.16812193085490285Illumina PCR Primer Index 2 (96% over 29bp)
TGAGATGAAGCACTGTAGCTCT63360.16302732688960275No Hit
AACATTCATTGCTGTCGGTGGGTT62940.16194665332120578No Hit
ACCGTGGCTTTAGATTGTTACT62090.15975957586135472No Hit
TGGACAACTCTTAGCGG62010.15955373327689815No Hit
TCCCTGAGACCCTAACTTGT61900.15927069972327038No Hit
TGAGATGAAGCACTGTAGCT61320.15777834098596025No Hit
CCCTGCGACCCTTAACCTGTGA61050.15708362226341935No Hit
TCCCTGAGACCCTTAACCTG60160.15479362351134No Hit
TAGCTTATCAGACTGGTGTTGG58640.15088261440666517No Hit
TAAGGCACGCGGTGAATGCCA58230.14982767116132528No Hit
TAAAGCTAGAGAACCGAAAGTAA58210.14977621051521114No Hit
AACCCGTAGATCCGAACTTG58130.14957036793075454No Hit
TTCACCGTGGCTAAGTTCTGC57840.1488241885620995No Hit
TATGGCTTTTTATTCCTATCTGA57140.14702306594810452No Hit
TAAGGCACGCGGTGAATGCC57090.14689441433281916No Hit
AGTTTTTGT56800.1461482349641641No Hit
TCCCTGAGACCCTTAACCTGTGT56580.14558216785690853No Hit
TGAGGTAGTAGGTTGTGTGGTT56060.14424419105794084No Hit
AGCTACATCTGGCTACTGGGTCTCT55180.14197992262891856No Hit
TTCAAGTAATCCAGGATAGGC53870.13860925030844223No Hit
AACATTCAACGATGTCGGTGAG53050.13649936381776243No Hit
AACATTCAACGCTGTCGGTGAGTT51780.13323161278951437No Hit
TGTAACCATCCTTGACTGGAAGCT51740.1331286914972861No Hit
TACCCTGTAGATCCGGATTTGTG51620.13281992762060124No Hit
CCACCCCGTTCCCGTGG51400.13225386051334567No Hit
TGAGGTAGTAGATTGAATAGTT49610.12764813268612993No Hit
TAGCAGCACGTAAATATTGGAG49450.1272364475172168No Hit
CCTTGGCTTTAGACTGCTTACT46080.11856532864698384No Hit
AGAATAATGCCAGCAGTCGGTC46060.11851386800086967No Hit
TGTCTGAGGGTCGCT45270.11648117247936107No Hit
TGTAAACATCCTACACTCTCAGCT45250.11642971183324692No Hit
TTCACAGTGGCTAAGTTCTG43450.11179825368297412No Hit
TGGACCACTCTTAGCGG43240.11125791689877561No Hit
AAGGTCCAACCTCACATGTCC43130.11097488334514784No Hit
CTACGCCTGTCTGAGGGTCGCT42340.10894218782363922No Hit
TGTGCAAATCCATGCAAAACTG41800.10755275037855738No Hit
AACATTCAACGCTGTCGGTGG41150.10588027937984774No Hit
AACTCCAGTCACCGATGTATCTCG41150.10588027937984774Illumina PCR Primer Index 2 (100% over 24bp)
AGCTACATTGTCTGCTGGGTT40830.10505690904202149No Hit
TCCCTGAGACCCTTAACCTGTGG40520.10425926902725227No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTATTCC100.0055785016157.1006823
TAACTGC201.4285597E-6157.1006823
TAACTAA100.0055785016157.1006823
CGTATGC379600.0155.8384123
CGTATTC100.0065049278149.233522
TACTAAC201.84501E-6149.233522
ATAAAAA151.09632594E-4149.233522
TGGTATG100.0065049278149.233522
TCGTATG380500.0147.8607822
AAACTAG100.007653892141.332221
ATAACTA2350.0139.7079622
CTCGTAT383550.0139.6187621
ATCACTA700.0138.5739622
ACACTGG700.0134.9038820
CAAACTA100.008796698134.9038720
TAGACGC100.008796698134.9038720
CATACTA151.6390631E-4134.9038720
CGATCAC1500.0134.9038720
CGATAAA400.0134.9038720
TCTCGTA382350.0134.1629320