FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_5_JM96_TTAGGC_L003_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_5_JM96_TTAGGC_L003_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2851326
Sequences flagged as poor quality0
Sequence length1-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG36195112.694128977184652No Hit
AACATTCAACGCTGTCGGTGAGT1966846.8979836048210545No Hit
AACCCGTAGATCCGAACTTGTG1164004.082311177325918No Hit
TTCAAGTAATCCAGGATAGGCT1072533.761513064447909No Hit
TCACAGTGAACCGGTCTCTTT659972.3146073090204347No Hit
TGAGGTAGTAGGTTGTATAGTT594992.0867133396882713No Hit
TAAAGCTAGAGAACCGAAAGTA591072.0729653501563834No Hit
TCCCTGAGACCCTTAACCTGT528371.85306766044991No Hit
AACATTCAACGCTGTCGGTGA481531.6887932141045954No Hit
TCCCTGAGACCCTTAACCTGTG478151.6769390802735291No Hit
CCACGTTCCCGTGG443661.555977815234035No Hit
TATTGCACTCGTCCCGGCCTCC338141.1859043827328057No Hit
TCCCTGAGACCCTTAACCTGTGA326271.1442746287166041No Hit
AGCTACATCTGGCTACTGGGTCTC325451.141398773763505No Hit
TAAAGCTAGAGAACCGAAAGT307211.0774285367579854No Hit
CCTGTCTGAGGGTCGCT274510.9627450526526957No Hit
AACATTCATTGCTGTCGGTGGG245010.8592844171448653No Hit
AACCCGTAGATCCGAACTTGT239660.8405212171459875No Hit
TAGCTTATCAGACTGGTGTTGGC221740.7776732650002139No Hit
TATTGCACTTGTCCCGGCCTGT183360.6430692246344332No Hit
TCTTTGGTTATCTAGCTGTATGA182110.6386852994010506No Hit
TTAAAGGGAATTTGCGACTGTT179920.6310046623921642No Hit
TAAAGCTAGAGAACCGAAAGTC175400.6151523887482526No Hit
AACATTCATTGCTGTCGGTGGGT163650.5739434915544558No Hit
TGAGGTAGTAGTTTGTATAGTT149880.5256501711835125No Hit
TCCCTGAGACCCTAACTTGTGA146780.5147780366047235No Hit
TACCCTGTAGAACCGAATTTGT139150.4880185569801559No Hit
TGAGGTAGTAGTTTGTGCTGTT135940.4767606369808293No Hit
AAGCTGCCAGCTGAAGAACTGT133030.4665548590375145No Hit
ACCTTGGCTTTAGACTGCTTACT119840.42029567997486084No Hit
CCCTGAGACCCTTAACCTGTGA114610.40195333679838785No Hit
TGAGGTAGTTGGTTGTATAGTT109920.38550484932273615No Hit
TCACAGTGAACCGGTCTCTT103410.36267336670727934No Hit
TCTTTGGTTATCTAGCTGTAT103030.36134065343633104No Hit
TCACAGTGAACCGGTCTCTTTT102180.3583595842776308No Hit
TCCCTGAGACCCTAACTTGT97800.34299831025985805No Hit
TCTTTGGTTATCTAGCTGTATG96980.34012245530675905No Hit
CCCTGCGACCCTTAACCTGTGA95850.3361593868957811No Hit
AGCTGGTGTTGTGAATCAGGCCG92490.3243753958684486No Hit
TCCCTGAGACCCTAACTTGTG91580.32118389829854604No Hit
TTGCATAGTCACAAAAGTGATC90190.31630897343902453No Hit
AAGCTGCCAGCTGAAGAACT90130.31609854502782214No Hit
CACCACGTTCCCGTGG90010.3156776882054174No Hit
TCCCTGAGACCCTTAACCTG89610.3142748321307349No Hit
AACCCGTAGATCCGAACTTGTGA88070.3088738362432075No Hit
TACCCTGTAGATCCGGATTTGT85870.3011581278324541No Hit
TGAGATGAAGCACTGTAGCTC84230.29540641792625605No Hit
TACCCTGTAGAACCGAATTTGCG83250.29196942054328406No Hit
TAAAGGGAATTTGCGACTGTT81410.2855162825997448No Hit
TCCCTGAGACCCTTAACCTGTGT74290.2605454444703973No Hit
TTCCCTTTGTCATCCTATGCCTG74050.25970373082558784No Hit
ACCATCGACCGTTGACTGTGCC73170.25661744746128645No Hit
CTGGACAACTCTTAGCGG71720.25153209419056255No Hit
TGAGGTAGTAGGTTGTATAGT71020.24907709605986827No Hit
TGTCTGAGGGTCGCT70030.24560502727502925No Hit
AACCCGTAGATCCGAACTTG69920.24521924185449154No Hit
TTCACAGTGGCTAAGTTCTGC67160.23553953493918267No Hit
AAGGTCCAACCTCACATGTCCT66830.23438217867756966No Hit
CTGTCTGAGGGTCGCT61750.2165659065291026No Hit
TAAAGCTAGAGAACCGAAAGTAT61360.2151981218562872No Hit
TTCACCGTGGCTAAGTTCTGC59260.20783312746420435No Hit
TAAAGCTAGAGAACCGAAAGTAA59020.2069914138193949No Hit
TACCCTGTAGAACCGAATGTGT56480.19808327774516135No Hit
AGCTACATTGTCTGCTGGGTTTC54540.1912794257829515No Hit
ACCACGTTCCCGTGG54300.19043771213814203No Hit
TACCCTGTAGAACCGAATTTGC53210.18661492933463236No Hit
AGCTACATCTGGCTACTGGGTCT53170.18647464372716413No Hit
TCCAGCATCAGTGATTTTGTT53060.18608885830662644No Hit
TGAGATGAAGCACTGTAGCT52990.18584335849355704No Hit
TCCCTGAGACCCTTAACCTGTGG51080.17914472073694837No Hit
AACATTCAACGCTGTCGGTGG50870.17840822129774006No Hit
TGGACAACTCTTAGCGG48600.1704470130739172No Hit
TGAGGTAGTTGGTTGTATTGTT47500.16658915886854045No Hit
TCCAGCATCAGTGATTTTGTTG46490.1630469472799673No Hit
TTCAAGTAATCCAGGATAGGC45740.1604165921399377No Hit
TGAGATGAAGCACTGTAGCTCT45010.15785637980364223No Hit
TCCCTGAGACCCTAACTTGTGC44500.1560677383084221No Hit
ACCGTGGCTTTAGATTGTTACT44000.15431416821506905No Hit
AGAATAATGCCAGCAGTCGGTC43930.15406866840199962No Hit
TAACAGTCTACAGTCATGGCT43770.15350752597212666No Hit
ACCATCGACCGTTGACTGTACC42800.15010559999102172No Hit
TTCACAGTGGCTAAGTTCTG42660.14961460036488286No Hit
AGCTACATTGTCTGCTGGGTTT42500.14905345793500988No Hit
TACCCTGTAGATCCGGATTTGTG42470.1489482437294087No Hit
AACATTCATTGCTGTCGGTGGGTT42420.1487728867200734No Hit
TGGACCACTCTTAGCGG42320.1484221727014028No Hit
TTCCCTTTGTCATCCTATGCCT42270.1482468156920675No Hit
CTACGCCTGTCTGAGGGTCGCT42220.14807145868273217No Hit
CAGGCTGGTTAGATGGTTGTCT39190.13744482391701265No Hit
TAGCTTATCAGACTGGTGTTGG38430.134779397375116No Hit
AGAATCATGCCAGCAGTCGGTC37880.13285047027242763No Hit
AACATTCAACGCTGTCGGTGAGTT37780.132499756253757No Hit
TCTTTGGTTATCTAGCTGTCTGA37160.13032532933799923No Hit
ACCATCGACCGTTGACTGTGCCT36950.12958882989879095No Hit
TTCACCGTGGCTAAGTTCTG36280.12723904597369784No Hit
ACTGGACAACTCTTAGCGG36190.12692340335689428No Hit
TCTTTGGTTATCTAGCTGTATGT34680.12162762167496807No Hit
AGCAGCATTGTACAGGGCTATGA34400.12064562242269036No Hit
AACATTCAACGCTGTCGGTGAGA34210.1199792657872162No Hit
TGAGGTAGTAGGTTGTGTGGTT33900.1188920523293373No Hit
CCCTGAGACCCTTAACCTGTGC33650.11801526728266076No Hit
AACATTCAACGATGTCGGTGAG33030.11584084036690297No Hit
TGAGGTAGTAGATTGAATAGTT32450.11380669905861343No Hit
TGAGGTAGTAGTTTGTGC32430.11373655625487931No Hit
TATTGCACTCGTCCCGGCCT30990.1086862743860225No Hit
AAGCTGCCAGTTGAAGAGCTGT30740.10780948933934598No Hit
TGAGGTAGTAGGTTGTATAGTTT30630.10742370391880829No Hit
CCCTGCGACCCTTAACCTGTGC30440.10675734728333414No Hit
ACCCTGTAGAACCGAATTTGCG30110.10559999102172113No Hit
TATTGCACTCGTCCCGGCCTC29970.10510899139558227No Hit
ACTGGCCAACTCTTAGCGG29230.10251370765741975No Hit
TAGCAGCACGTAAATATTGGAG28870.10125113719020554No Hit
TATGGCTTTTTATTCCTATCTG28670.1005497091528643No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATTTATA57.077095E-43395.277323
TCCATCC57.077095E-43395.277323
AAATAAC57.077095E-43395.277323
AGATAAT57.077095E-43395.277323
CCGTGTT57.077095E-43395.277323
ACATGTT57.077095E-43395.277323
TCACTAA105.51363E-73395.277323
GATTCCT105.51363E-73395.277323
TCGACCT57.077095E-43395.277323
ACCTTTA105.51363E-73395.277323
TAACTAA154.0563464E-103395.277323
AAGTCAT57.077095E-43395.277323
CAACCCG650.02872.92723
AATAACC400.02546.45823
ATCACTA350.01721.170422
ATAAAAA156.217306E-91721.170322
GGGTGAT50.00275875951721.170222
AAATATC50.00275875951721.170222
TCTCTAA50.00275875951721.170222
CCTAGAA50.00275875951721.170222