FastQCFastQC Report
Wed 7 Dec 2016
nfu_brain_mzm_5_JM97_TGACCA_L005_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_brain_mzm_5_JM97_TGACCA_L005_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4834088
Sequences flagged as poor quality0
Sequence length1-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG48539810.041149437080996No Hit
AACATTCAACGCTGTCGGTGAGT3053306.316186217545068No Hit
TTCAAGTAATCCAGGATAGGCT1891803.913457926293439No Hit
AACCCGTAGATCCGAACTTGTG1589033.2871350293995474No Hit
TAAAGCTAGAGAACCGAAAGTA1315262.7208027656923086No Hit
TCACAGTGAACCGGTCTCTTT1293192.675147825194742No Hit
TGAGGTAGTAGGTTGTATAGTT1066872.206972649236009No Hit
TCCCTGAGACCCTTAACCTGTG789541.6332760181444774No Hit
TCCCTGAGACCCTTAACCTGT751811.5552261357261183No Hit
AGCTACATCTGGCTACTGGGTCTC700481.4490427149857428No Hit
AACATTCAACGCTGTCGGTGA685841.4187577884391016No Hit
CCACGTTCCCGTGG607301.2562866046294565No Hit
TCTTTGGTTATCTAGCTGTATGA504411.0434439753682598No Hit
TCCCTGAGACCCTTAACCTGTGA491361.016448190434266No Hit
TAAAGCTAGAGAACCGAAAGT471680.9757373055682892No Hit
CCTGTCTGAGGGTCGCT444650.9198218981532814No Hit
TATTGCACTCGTCCCGGCCTCC434110.8980184059537186No Hit
AACATTCATTGCTGTCGGTGGG379130.7842844400019197No Hit
TAGCTTATCAGACTGGTGTTGGC357290.7391052872847992No Hit
TTAAAGGGAATTTGCGACTGTT322560.6672613324374732No Hit
TGAGGTAGTAGTTTGTATAGTT317010.6557803664310621No Hit
AACCCGTAGATCCGAACTTGT301750.6242128815197406No Hit
TCCCTGAGACCCTAACTTGTGA282720.5848466142941543No Hit
AACATTCATTGCTGTCGGTGGGT272360.5634154777488536No Hit
TCTTTGGTTATCTAGCTGTAT260660.5392123602218247No Hit
CCCTGAGACCCTTAACCTGTGA255050.5276072756639928No Hit
TCTTTGGTTATCTAGCTGTATG254530.5265315815516804No Hit
TGAGGTAGTAGTTTGTGCTGTT251070.5193740784197557No Hit
TATTGCACTTGTCCCGGCCTGT243360.5034248445622008No Hit
ACCTTGGCTTTAGACTGCTTACT210130.4346838535003914No Hit
TCACAGTGAACCGGTCTCTTTT201310.41643842644155427No Hit
TTGCATAGTCACAAAAGTGATC199050.41176329433804265No Hit
AAGCTGCCAGCTGAAGAACTGT193720.40073742968684056No Hit
TCACAGTGAACCGGTCTCTT192600.3984205500603216No Hit
AGCTGGTGTTGTGAATCAGGCCG183920.3804647329547993No Hit
TACCCTGTAGAACCGAATTTGT178710.3696871054064386No Hit
TGAGGTAGTTGGTTGTATAGTT176290.3646809904991386No Hit
CACCACGTTCCCGTGG155720.3221290137870887No Hit
TTCACAGTGGCTAAGTTCTGC150750.3118478604444106No Hit
TAAAGGGAATTTGCGACTGTT148270.30671762698568994No Hit
TCCCTGAGACCCTAACTTGT140630.29091319810479244No Hit
TGAGATGAAGCACTGTAGCTC134200.27761182667754497No Hit
TCCCTGAGACCCTAACTTGTG130350.26964755296138593No Hit
TCCCTGAGACCCTTAACCTG125480.25957326387107554No Hit
TACCCTGTAGATCCGGATTTGT125190.2589733575392091No Hit
TTCCCTTTGTCATCCTATGCCTG120050.24834053496750577No Hit
TAAAGCTAGAGAACCGAAAGTAA119860.247947492888007No Hit
TGAGGTAGTAGGTTGTATAGT119300.2467890530747475No Hit
AAGCTGCCAGCTGAAGAACT117720.24352059788733676No Hit
TCCCTGAGACCCTTAACCTGTGT117170.24238284449931402No Hit
AACCCGTAGATCCGAACTTGTGA114100.23603211195162357No Hit
CTGGACAACTCTTAGCGG111230.23009510790866858No Hit
TGTCTGAGGGTCGCT109920.22738518620265083No Hit
TAAAGCTAGAGAACCGAAAGTAT109230.22595782286131322No Hit
AAGGTCCAACCTCACATGTCCT106430.22016562379501572No Hit
CTGTCTGAGGGTCGCT105370.2179728627199174No Hit
TACCCTGTAGAACCGAATTTGCG102920.21290468853690706No Hit
TGTAAACATCCTTGACTGGAAGCT102170.2113532066441488No Hit
TAACAGTCTACAGTCATGGCT101550.21007064827946864No Hit
ACCATCGACCGTTGACTGTGCC99920.20669876096587403No Hit
AACATTCAACGCTGTCGGTGG97120.2009065618995765No Hit
AGCTACATTGTCTGCTGGGTTTC97030.20072038407244552No Hit
AGCTACATCTGGCTACTGGGTCT94490.1954660320623042No Hit
TCCCTGAGACCCTTAACCTGTGG94190.1948454393052009No Hit
TCTTTGGTTATCTAGCTGTATGT90820.1878741140004071No Hit
AGAATAATGCCAGCAGTCGGTC90000.1861778271309914No Hit
CTACGCCTGTCTGAGGGTCGCT87990.1820198556583993No Hit
TTCACAGTGGCTAAGTTCTG87730.18148200860224306No Hit
ACCACGTTCCCGTGG87080.18013739096185258No Hit
ACCGTGGCTTTAGATTGTTACT85030.17589667378831333No Hit
TTCAAGTAATCCAGGATAGGC79870.1652224783661365No Hit
TACCCTGTAGAACCGAATGTGT79720.16491218198758484No Hit
TGAGGTAGTTGGTTGTATTGTT79650.1647673770109274No Hit
CCCTGCGACCCTTAACCTGTGA78920.16325726796864268No Hit
TCCAGCATCAGTGATTTTGTT78440.1622643195572774No Hit
AACCCGTAGATCCGAACTTG76040.15729957750045095No Hit
AGCTACATTGTCTGCTGGGTTT75670.1565341797666902No Hit
CTTTGGTTATCTAGCTGTATGA75050.15525162140201004No Hit
TACCCTGTAGATCCGGATTTGTG74680.15448622366824932No Hit
TGGACAACTCTTAGCGG74220.1535346481073576No Hit
TCCAGCATCAGTGATTTTGTTG73920.1529140553502543No Hit
TTCCCTTTGTCATCCTATGCCT73180.1513832598827328No Hit
TGAGATGAAGCACTGTAGCTCT72180.1493146173590551No Hit
TGAGATGAAGCACTGTAGCT70150.14511527303598942No Hit
AACATTCATTGCTGTCGGTGGGTT69560.14389477394701958No Hit
ACTGGACAACTCTTAGCGG69300.14335692689086338No Hit
TGCTCAGTAGTCAGTGTAGATCC68730.1421778006523671No Hit
ACCATCGACCGTTGACTGTACC68370.14143308934384313No Hit
AGCAGCATTGTACAGGGCTATGA67620.13988160745108488No Hit
TGTAAACATCCTACACTCTCAGCT67590.13981954817537454No Hit
AACATTCAGCGCTGTCGGTGAG66930.13845424410974727No Hit
CAGGCTGGTTAGATGGTTGTCT66160.13686138936651546No Hit
TACCCTGTAGAACCGAATTTGC66120.13677864366556836No Hit
TGAGGTAGTAGTTTGTGC64530.13348950205292084No Hit
TAAAGCTAGAGAACCGAAAGTC64090.13257929934250265No Hit
AACATTCAACGCTGTCGGTGAGTT62480.1292487848793816No Hit
TAGCTTATCAGACTGGTGTTGG61890.12802828579041176No Hit
TGAGGTAGTAGGTTGTGTGGTT61160.12651817674812707No Hit
TGAGGTAGTAGGTTGTATAGTTT57270.11847115733102087No Hit
AACATTCGACGCTGTCGGTGAG56670.11722997181681424No Hit
CCTTGGCTTTAGACTGCTTACT55930.11569917634929278No Hit
CATTGCACTTGTCTCGGTCTGA55710.11524407499408369No Hit
AAGCTGCCAGTTGAAGAGCTGT52270.10812794471263246No Hit
TTCACCGTGGCTAAGTTCTGC50840.10516978590377336No Hit
AACATTCAACGCTGTCGGTGAGA49810.10303908410438536No Hit
TAGCAGCACGTAAATATTGGAG48950.10126005153402255No Hit
TGAGGTAGTAGATTGAATAGTT48660.10066014520215602No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCAGCTT53.2835102E-44986.14123
CTTCTAT53.2835102E-44986.14123
CGCAACC53.2835102E-44986.14123
AAAGGCC53.2835102E-44986.14123
TAACTGC400.04986.14123
AATAACC202.764864E-103739.60623
TAACTAA155.8849946E-73324.094523
AAATAGA100.00131322972493.070623
CAACCCG401.8189894E-122493.070623
TAAACCA201.394752E-62493.070623
TCACTAA100.00131322972493.070623
ATCTGCA100.00131322972493.070623
TGCCGCC100.00131322972493.070623
TCACTGA1400.02314.994423
GCCTTGG50.00163904242233.610822
AGTCATA50.00163904242233.610822
ATCACTA900.02233.610822
ACTTAAG50.00163904242233.610822
GTGGATT50.00163904242233.610822
AACGCGC50.00163904242233.610822