FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_10_JG57_3_GGCTAC_L008_R1_001_TRIMMED_prinseq_good_4sqm.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_10_JG57_3_GGCTAC_L008_R1_001_TRIMMED_prinseq_good_4sqm.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8762785
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC5483346.257531138787497No Hit
ATGACCTATGAATTGACAGCCA4967445.668791371692904No Hit
TTCAAGTAATCCAGGATAGGCT4761925.434254064204474No Hit
CCTGTCTGAGGGTCGCT3963584.52319667776854No Hit
TGAGGTAGTAGGTTGTATAGTT2666623.043119282282973No Hit
AAGCTGCCAGCTGAAGAACTGT2137422.4392016921560895No Hit
TCAGTAACTGGAATCTGTCCCT2076372.369532060868776No Hit
AACATTCAACGCTGTCGGTGAG1524241.739446990882465No Hit
AACATTCAACGCTGTCGGTGAGT1491011.7015252570957748No Hit
CTACGCCTGTCTGAGGGTCGCT1300471.48408297133845No Hit
TATTGCACTTGTCCCGGCCTGT1247261.4233602673122756No Hit
TAGCTTATCAGACTGGTGTTGGC1206061.3763432516032288No Hit
TGTAAACATCCTTGACTGGAAGCT1091121.2451749072926015No Hit
AACTCCAGTCACGGCTACATCTCGTATGC1079081.2314349832844238Illumina PCR Primer Index 11 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTT938091.0705386472451395No Hit
CTGTCTGAGGGTCGCT872040.9951630674494467No Hit
TGTAAACATCCTACACTCTCAGCT734360.8380440693227097No Hit
TGTCTGAGGGTCGCT720290.8219875302201298No Hit
TGAGATGAAGCACTGTAGCTC679330.7752444000394851No Hit
TGGAGTGTGACAATGGTGTTTG670370.7650193403124691No Hit
TTCAAGTAATCCAGGATAGGTT615400.7022881424113453No Hit
TCAGTAACTGGAATCTGTCCCTGC614710.7015007215171889No Hit
TGAGATGAAGCACTGTAGCTCT526070.6003456663606377No Hit
ACAGTAGTCTGCACATTGGTT475730.5428981767782731No Hit
CCACGTTCCCGTGG440590.5027967706613822No Hit
AACCCGTAGATCCGAACTTGTG438010.4998525012310584No Hit
TTCACAGTGGCTAAGTTCTG435330.496794112830567No Hit
TCAGTAACTGGAATCTGTCCCTG430340.49109957621920425No Hit
TTCACAGTGGCTAAGTTCTGC428300.4887715492277855No Hit
GGACAACTCTTAGCGG425350.4854050396078416No Hit
TTCCAGTGATGACAGCCTATAATCTGACT417190.47609293164216626No Hit
CTGGACAACTCTTAGCGG395720.45159158874718486No Hit
TACGCCTGTCTGAGGGTCGCT370640.42297055102915343No Hit
TGTAAACATCCCCGACTGGAAGCT360030.4108625282943722No Hit
TTCACAGTGGTTAAGTTCTG338170.3859161214157371No Hit
TCCAGTGATGACAGCCTATAATCTGACT327030.3732032681390677No Hit
ATGACCTATGAATTGACAGCCAT318430.36338903670465494No Hit
AACATTCAACGCTGTCGGTGA315970.3605817100385323No Hit
AACTCCAGTCACGGCTACATCT313360.3576032049171582Illumina PCR Primer Index 11 (100% over 22bp)
TGAGGTAGTAGATTGAATAGTT312040.356096834510946No Hit
TGAGGTAGTAGGTTGTATAGTTT301260.34379480952687985No Hit
TGAGGTAGTAGTTTGTGCTGTT300770.34323562657305867No Hit
TGAGGTAGTAGGTTGTATAGT288550.32929028841857927No Hit
CATTGCACTTGTCTCGGTCTGA283670.32372128267440087No Hit
CATTATTACTTTTGGTACGCG269430.30747074132253616No Hit
ACTGGACAACTCTTAGCGG268960.3069343821627485No Hit
TGTAAACATCCTACACTCAGCT261930.29891181855996696No Hit
TCGTACCGTGAGTAATAATGCA256850.2931145748754534No Hit
TGAGATGAAGCACTGTAGCT253380.28915464661063806No Hit
TGGAGTGTGACAATGGTGTTTGT235780.2690697078611423No Hit
TATTGCACTTGTCCCGGCCTGTT234940.2681111085117346No Hit
TTCAAGTAATCCAGGATAGGC227260.2593467716028637No Hit
ATGACCTATGAATTGACAGC216600.24718168938299864No Hit
TTCAAGTAATCCAGGATAGGCTT213210.24331305629431738No Hit
TGTAAACATCCCCGACTGGAAGC208920.23841735247412782No Hit
AACTGGACAACTCTTAGCGG203230.23192398307159195No Hit
TAGCTTATCAGACTGGTGTTGG198780.22684568889913423No Hit
CCTGTCTGAGGGTCGCTT188060.21461213529716866No Hit
TGGAGTGTGACAATGGTGTTT186610.21295741022973863No Hit
TGTAAACATCCTTGACTGGAAGC181410.20702322378102395No Hit
TTTTGCAGAAACGTTTCAGATT180950.20649827651825306No Hit
AAGCTGCCAGCTGAAGAACT176030.2008836231860076No Hit
ACAGTAGTCTGCACATTGGTTA171350.19554285538216448No Hit
AACTCCAGTCACGGCTACATCTC171100.1952575579567455Illumina PCR Primer Index 11 (100% over 23bp)
TCCCATATGGTCTAGCGGTTAGGATTCCT158710.18111821755298116No Hit
TCACAGTGAACCGGTCTCTTT157780.18005691113042258No Hit
TCGTACCGTGAGTAATAATGC157110.17929231403029972No Hit
GAAGGATCATTA156470.17856195262122715No Hit
TGTAACAGCAACTCCATGTGGA154960.17683875617169656No Hit
TGTAAACATCCCCGACTGGA154120.1758801568222888No Hit
TATTGCACTTGTCCCGGCCTGTA151440.17282176842179742No Hit
TTCACAGTGGTTAAGTTCTGC150240.17145234077978633No Hit
CCTCGATCCAAGTTTTTGT146710.16742394113287043No Hit
AAGTTCTGTGATACACTCAGACT143600.1638748411606584No Hit
AACTCCAGTCACGGCTACATCTCG138880.15848842576874816Illumina PCR Primer Index 11 (100% over 24bp)
ATGACCTATGAATTGACAGCCT137260.15663969845203324No Hit
TGAGGTAGTTGTTTGTACAGTT134080.1530107152007039No Hit
AACATTCATTGCTGTCGGTGGG132640.15136740203029062No Hit
TATTGCACTTGTCCCGGCCTGTTT129880.14821771845366513No Hit
TACCCTGTAGAACCGAATTTGCG129560.14785253774912885No Hit
CGCCTGTCTGAGGGTCGCT129400.14766994739686068No Hit
TGGACAACTCTTAGCGG129180.147418885662492No Hit
TATTGCACTTGTCCCGGCCTGTAT127210.1451707419501905No Hit
TAACGGAACCCATAATGCAGCTG125400.14310518859015714No Hit
TCAGTGCATTACAGAACTTTGT124110.14163305387499522No Hit
TGAGGTAGTAAGTTGTGTTGTT124070.1415874062869282No Hit
TGTAAACATCCTACACTCTCAGC122530.13982997414634732No Hit
TACAGTACTGTGATAACTGAAG116250.1326633028198227No Hit
TCCCTGAGACCCTAACTTGTGA113650.12969620959546538No Hit
TTCACAGTGGTTAAGTTCTGCC105550.12045257301189062No Hit
AACATTCATTGCTGTCGGTGGGT104280.11900326209076223No Hit
TACCCTGTAGATCCGGATTTGT104220.11893479070866168No Hit
CTCGATCCAAGTTTTTGT104170.11887773122357789No Hit
AAACCGTTACCATTACTGAGTTT103460.11806748653538801No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC102630.11712029908299702No Hit
TGAGAACTGAATTCCATAGATGG101750.11611605214552223No Hit
TTCACAGTGGCTAAGTTCTGCT99950.11406191068250562No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT94200.10750006989786923No Hit
TGAGGTAGTTGGTTGTATAGTT93260.10642735157829389No Hit
GAGAGAGGCATGATCGTAGCGATA91340.10423626735107618No Hit
TACCCTGTAGAACCGAATTTGT91300.10419061976300913No Hit
GTACAGTACTATGATAACTGAA88200.10065293168781386No Hit
TACAGTACTATGATAACTGAA87730.1001165725280262No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCGTTC300.0421.4218823
CGTATGC118250.0408.2357223
TAACTGC3250.0389.004823
CAACCCG5050.0371.3519323
TAACTAA400.0368.7441423
GCTTCCT1550.0367.0448623
GATTCCT17850.0342.331523
AATAACC2200.0335.2219523
CGTGTGC159.794062E-4280.947923
AGTATTT550.0268.1775523
ATATGAC151.0749727E-5267.1686722
ATCACTA400.0267.1686722
TCGATCG100.0011387735267.1686722
TACTAAC309.094947E-12267.1686722
TCTCGCC10350.0264.6610723
ATAACTA5450.0257.3643222
TCGTATG120100.0256.4908422
ACATAGC251.3387491E-5252.853123
ACAACCC12900.0248.52922
TCCCGTT700.0248.0851722