FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_10_JG58_3_CTTGTA_L007_R1_001_TRIMMED_prinseq_good_BVeM.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_10_JG58_3_CTTGTA_L007_R1_001_TRIMMED_prinseq_good_BVeM.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6215718
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC4226226.799246683971185No Hit
ATGACCTATGAATTGACAGCCA3773556.0709800541144245No Hit
TTCAAGTAATCCAGGATAGGCT3612865.812458029788353No Hit
CCTGTCTGAGGGTCGCT3151045.069470654878487No Hit
TGAGGTAGTAGGTTGTATAGTT1665602.6796582470440264No Hit
AAGCTGCCAGCTGAAGAACTGT1527982.458251806146933No Hit
TCAGTAACTGGAATCTGTCCCT1360982.1895780986203044No Hit
AACATTCAACGCTGTCGGTGAGT1237281.9905664960990828No Hit
AACATTCAACGCTGTCGGTGAG1205831.9399689625558947No Hit
TAGCTTATCAGACTGGTGTTGGC1149261.848957755161994No Hit
TATTGCACTTGTCCCGGCCTGT1027151.6525041837483618No Hit
TGTAAACATCCTTGACTGGAAGCT889831.4315803902300588No Hit
CTACGCCTGTCTGAGGGTCGCT885901.425257709567905No Hit
CTGTCTGAGGGTCGCT718721.1562944136140025No Hit
AACTCCAGTCACCTTGTAATCTCGTATGC675951.0874849856444582Illumina PCR Primer Index 12 (100% over 29bp)
TGTCTGAGGGTCGCT630611.0145408784632766No Hit
TGAGATGAAGCACTGTAGCTC628581.0112749645334618No Hit
TGAGGTAGTAGTTTGTATAGTT560780.9021966569268425No Hit
TGTAAACATCCTACACTCTCAGCT498940.8027069439121917No Hit
TGAGATGAAGCACTGTAGCTCT458120.7370347239047846No Hit
TCAGTAACTGGAATCTGTCCCTGC456090.73376880997497No Hit
TGGAGTGTGACAATGGTGTTTG420290.6761728894393214No Hit
TTCAAGTAATCCAGGATAGGTT399500.6427254260891502No Hit
TTCACAGTGGCTAAGTTCTGC387150.6228564423289473No Hit
TTCACAGTGGCTAAGTTCTG369490.5944445999641554No Hit
ACAGTAGTCTGCACATTGGTT305050.49077194299998805No Hit
TCAGTAACTGGAATCTGTCCCTG294360.47357360806909193No Hit
CCACGTTCCCGTGG290110.46673610353622863No Hit
AACCCGTAGATCCGAACTTGTG280300.4509535342497842No Hit
AACATTCAACGCTGTCGGTGA277630.44665797257855006No Hit
TGTAAACATCCCCGACTGGAAGCT273930.4407053215734691No Hit
TACGCCTGTCTGAGGGTCGCT272440.43830817292547697No Hit
GGACAACTCTTAGCGG268700.4322911689365573No Hit
TTCACAGTGGTTAAGTTCTG258880.4164925114041531No Hit
CTGGACAACTCTTAGCGG234410.3771245735408202No Hit
CATTATTACTTTTGGTACGCG232110.37342427697009417No Hit
AACTCCAGTCACCTTGTAATCT231940.37315077678877967Illumina PCR Primer Index 12 (100% over 22bp)
CATTGCACTTGTCTCGGTCTGA231490.37242680572059417No Hit
TGAGATGAAGCACTGTAGCT223270.35920226754173856No Hit
TGAGGTAGTAGTTTGTGCTGTT219780.35358746970181076No Hit
TTCCAGTGATGACAGCCTATAATCTGACT215240.34628340603611685No Hit
ATGACCTATGAATTGACAGCCAT206370.3320131318698821No Hit
TCGTACCGTGAGTAATAATGCA202450.3257065394536882No Hit
TGAGGTAGTAGATTGAATAGTT191720.3084438515389533No Hit
TATTGCACTTGTCCCGGCCTGTT184090.29616851987171877No Hit
TCCAGTGATGACAGCCTATAATCTGACT177590.28571115999792784No Hit
TGAGGTAGTAGGTTGTATAGT162670.26170749702608775No Hit
TGAGGTAGTAGGTTGTATAGTTT161310.25951949557557147No Hit
TTCAAGTAATCCAGGATAGGC159790.2570740821897004No Hit
CCTGTCTGAGGGTCGCTT153210.246488016348232No Hit
ACTGGACAACTCTTAGCGG152180.24483092701438514No Hit
TGTAAACATCCCCGACTGGAAGC149720.2408732185083043No Hit
AACTCCAGTCACCTTGTAATCTC148360.238685217057788Illumina PCR Primer Index 12 (100% over 23bp)
ATGACCTATGAATTGACAGC147870.23789689300576378No Hit
TGTAAACATCCTACACTCAGCT147010.2365133038532314No Hit
TAGCTTATCAGACTGGTGTTGG146540.23575715629312655No Hit
TTCAAGTAATCCAGGATAGGCTT137070.22052158736931118No Hit
TGGAGTGTGACAATGGTGTTTGT132900.2138127888041253No Hit
TGTAAACATCCTTGACTGGAAGC131960.21230049368391551No Hit
AAGCTGCCAGCTGAAGAACT126920.20419201772023765No Hit
TGTAACAGCAACTCCATGTGGA126600.2036771938495279No Hit
TCACAGTGAACCGGTCTCTTT119500.1922545392181563No Hit
AACTGGACAACTCTTAGCGG118600.19080659708178524No Hit
CAGTCGGTAGAGCATC114140.18363123938376869No Hit
TTCACAGTGGTTAAGTTCTGC113160.18205459127972023No Hit
TACCCTGTAGATCCGGATTTGT111750.1797861485994056No Hit
CGCCTGTCTGAGGGTCGCT107500.17294864406654226No Hit
TACCCTGTAGATCCGGATTTGTG105900.17037452471299375No Hit
TGAGGTAGTTGTTTGTACAGTT103430.16640072796095318No Hit
ACAGTAGTCTGCACATTGGTTA103010.1657250216306467No Hit
TATTGCACTTGTCCCGGCCTGTTT102800.16538716846549345No Hit
TGTAAACATCCCCGACTGGA102500.1649045210867031No Hit
TATTGCACTTGTCCCGGCCTGTA101960.16403575580488047No Hit
AACTCCAGTCACCTTGTAATCTCG101730.16366572614780786Illumina PCR Primer Index 12 (100% over 24bp)
TCGTACCGTGAGTAATAATGC101290.16295784332558202No Hit
TGGAGTGTGACAATGGTGTTT98330.15819572252151723No Hit
TTTGTTCGTTCGGCTCGCGTTA93860.151004276577541No Hit
AAACCGTTACCATTACTGAGTTT93060.14971721690076675No Hit
TTTTGCAGAAACGTTTCAGATT92490.14880018688106506No Hit
TGAGAACTGAATTCCATAGATGG92030.14806012756691986No Hit
ATGACCTATGAATTGACAGCCT90780.14604909682196007No Hit
GAAGGATCATTA89870.14458506643962935No Hit
TATTGCACTTGTCCCGGCCTGTAT89280.1436358599280083No Hit
AACATTCATTGCTGTCGGTGGG89120.14337844799265348No Hit
TACCCTGTAGAACCGAATTTGCG87170.1402412400305162No Hit
TTCACAGTGGCTAAGTTCTGCT84400.13578479589968528No Hit
TACAGTACTGTGATAACTGAAG84300.1356239134400885No Hit
TGGACAACTCTTAGCGG83180.13382202989260453No Hit
TCGGTAGAGCATGAGACT80090.1288507618910639No Hit
TAGCTTATCAGACTGGTGTTGGCT79200.12741890800065256No Hit
CCTCGATCCAAGTTTTTGT78780.12674320167034603No Hit
AACATTCATTGCTGTCGGTGGGT77130.12408864108699913No Hit
TAACGGAACCCATAATGCAGCTG76960.1238151409056846No Hit
TTCACAGTGGTTAAGTTCTGCC76800.12355772897032974No Hit
GTACAGTACTATGATAACTGAA75440.12136972751981348No Hit
AACTCCAGTCACCTTGTAATCTCGTAT73560.11834513727939394Illumina PCR Primer Index 12 (100% over 27bp)
TGAGGTAGTAAGTTGTGTTGTT72330.11636628302635352No Hit
AGCTACATCTGGCTACTGGGTCTC70720.11377607542684531No Hit
TTTGTTCGTTCGGCTCGCGTT70400.11326125155613559No Hit
TCAGTGCATTACAGAACTTTGT69340.1115558974844097No Hit
AAGTTCTGTGATACACTCAGACT68230.10977010218288538No Hit
TCCCTGAGACCCTAACTTGTGA67530.1086439249657079No Hit
CTTTCAGTCGGATGTTTGCAGC67400.1084347777682321No Hit
AAGGTCCAACCTCACATGTCCT66510.10700292387782072No Hit
TACCCTGTAGAACCGAATTTGT65880.10598936438236098No Hit
TATTGCACTTGTCCCGGCCTGTAA65350.10513668734649802No Hit
TGTAAACATCCTACACTCTCAGC65140.10479883418134477No Hit
CACGTTCCCGTGG62570.10066415496970745No Hit
CTCGATCCAAGTTTTTGT62410.1004067430343526No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC74050.0548.552723
CAACCCG2050.0546.9051523
TAACTGC1650.0505.2604423
TAACTAA201.5875412E-6431.2136223
GATTCCT6550.0408.171723
AGTATTT153.8605448E-4383.3010323
TAACTAC153.8605448E-4383.3010323
ATCACTA152.7549122E-6375.6862822
ATAACTA2700.0375.6862522
ACAACCC6650.0370.0368322
TCGTATG75350.0355.7427422
TTCTGGC650.0346.7873522
ATATGAC450.0333.9433622
CATAGCT453.2923708E-10319.4175423
AATAACC900.0319.4175423
AGGCTTC255.456968E-10293.573521
AGCTCCC108.585991E-4293.5734621
GCTTCCT308.014626E-6287.4757723
GACAACC10300.0282.1725821
CCCGAAT208.6883865E-6281.7646822