FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_10_JG59_3_AGTCAA_L006_R1_001_TRIMMED_prinseq_good_kBBq.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_10_JG59_3_AGTCAA_L006_R1_001_TRIMMED_prinseq_good_kBBq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8772020
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT4582535.224030496966491No Hit
ATGACCTATGAATTGACAGCCA4513145.1449267101534195No Hit
ATGACCTATGAATTGACAGCC4357644.967658532470287No Hit
CCTGTCTGAGGGTCGCT3185633.6315808673486836No Hit
TAGCTTATCAGACTGGTGTTGGC2482062.8295193125414673No Hit
TGAGGTAGTAGGTTGTATAGTT2173592.477867127525929No Hit
TCAGTAACTGGAATCTGTCCCT1916412.184684941438802No Hit
AAGCTGCCAGCTGAAGAACTGT1756302.0021614177806253No Hit
AACATTCAACGCTGTCGGTGAGT1484451.692255603612395No Hit
AACATTCAACGCTGTCGGTGAG1353681.5431793361164248No Hit
TATTGCACTTGTCCCGGCCTGT1322041.507110106908101No Hit
TGTAAACATCCTTGACTGGAAGCT1019831.1625942485311251No Hit
CTACGCCTGTCTGAGGGTCGCT938581.0699702007063367No Hit
TAACGGAACCCATAATGCAGCTG822760.9379367580101278No Hit
CTGTCTGAGGGTCGCT723200.8244395247616854No Hit
TGAGATGAAGCACTGTAGCTC704120.8026885483617229No Hit
TCAGTAACTGGAATCTGTCCCTGC688620.7850187300074555No Hit
TGAGGTAGTAGTTTGTATAGTT670420.7642709432947029No Hit
TGTAAACATCCTACACTCTCAGCT609420.6947316581585541No Hit
TGAGATGAAGCACTGTAGCTCT599320.6832177765212574No Hit
TGTCTGAGGGTCGCT593770.6768908415621487No Hit
AACTCCAGTCACAGTCAAATCTCGTATGC593240.6762866477732609TruSeq Adapter, Index 13 (96% over 29bp)
TTCAAGTAATCCAGGATAGGTT537430.6126639018150893No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT534410.6092211372067096No Hit
TTCACAGTGGCTAAGTTCTGC504500.5751240877243782No Hit
TCAGTAACTGGAATCTGTCCCTG457660.5217270366460633No Hit
TTCACAGTGGCTAAGTTCTG456320.5201994523496298No Hit
TGGAGTGTGACAATGGTGTTTG452220.5155255003978559No Hit
AACTCCAGTCACAGTCAAATCT398820.4546501261967027TruSeq Adapter, Index 13 (95% over 22bp)
TTCCAGTGATGACAGCCTATAATCTGACT377220.4300263793288205No Hit
TAGCTTATCAGACTGGTGTTGG365650.41683671491857066No Hit
CCACGTTCCCGTGG361660.41228816167769794No Hit
ACAGTAGTCTGCACATTGGTT361160.4117181675372377No Hit
TTCACAGTGGTTAAGTTCTG351950.40121887546996016No Hit
TGAGAACTGAATTCCATAGATGG336540.3836516560609757No Hit
ATGACCTATGAATTGACAGCCAT324230.3696184003228447No Hit
TGAGGTAGTAGATTGAATAGTT317900.3624022745046181No Hit
TGTAAACATCCCCGACTGGAAGCT312060.35574474294404257No Hit
AACATTCAACGCTGTCGGTGA306840.34979400411763767No Hit
AACCCGTAGATCCGAACTTGTG303800.3463284397436394No Hit
TCGTACCGTGAGTAATAATGCA303500.3459864432593633No Hit
TCCAGTGATGACAGCCTATAATCTGACT300460.3425208788853651No Hit
TACGCCTGTCTGAGGGTCGCT298210.339955905253294No Hit
CATTGCACTTGTCTCGGTCTGA284230.3240188690860258No Hit
GGACAACTCTTAGCGG283110.32274208221139483No Hit
TGAGGTAGTAGGTTGTATAGTTT265780.30298608530304305No Hit
CATTATTACTTTTGGTACGCG263320.30018171413197875No Hit
TATTGCACTTGTCCCGGCCTGTT262620.2993837223353344No Hit
TGAGGTAGTAGTTTGTGCTGTT259010.2952683646412115No Hit
AACTCCAGTCACAGTCAAATCTC254350.2899560192521221TruSeq Adapter, Index 13 (95% over 23bp)
CTGGACAACTCTTAGCGG249040.2839026814804344No Hit
TGAGGTAGTAGGTTGTATAGT235960.2689916347659946No Hit
TTCAAGTAATCCAGGATAGGCTT214550.2445844856714873No Hit
TGAGATGAAGCACTGTAGCT213640.24354709633584967No Hit
TTCAAGTAATCCAGGATAGGC204600.2332416022763286No Hit
AACTCCAGTCACAGTCAAATCTCG203790.232318211768783TruSeq Adapter, Index 13 (95% over 24bp)
TGTAAACATCCTACACTCAGCT203080.2315088200893295No Hit
TGTAAACATCCCCGACTGGAAGC201440.2296392393086199No Hit
TGGAGTGTGACAATGGTGTTTGT193520.22061053212372975No Hit
TACCCTGTAGATCCGGATTTGT193010.22002913810046035No Hit
TGTAAACATCCTTGACTGGAAGC189880.21646097478117926No Hit
TCGTACCGTGAGTAATAATGC180230.20546008787029668No Hit
TTCACAGTGGTTAAGTTCTGC174250.19864295795039227No Hit
ATGACCTATGAATTGACAGC174170.19855175888791862No Hit
ACTGGACAACTCTTAGCGG170030.1938322074049079No Hit
AAGCTGCCAGCTGAAGAACT168140.1916776295539682No Hit
TATTGCACTTGTCCCGGCCTGTA154490.17611678951940374No Hit
TACCCTGTAGAACCGAATTTGCG154140.17571779362108159No Hit
TATTGCACTTGTCCCGGCCTGTTT152520.17387101260599042No Hit
TTTGTTCGTTCGGCTCGCGTTA150870.17199003194247164No Hit
TATTGCACTTGTCCCGGCCTGTAT147640.1683078697950985No Hit
TAGCTTATCAGACTGGTGTTGGCT147380.16801147284205917No Hit
CCTGTCTGAGGGTCGCTT146830.16738447928755293No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC146710.16724768069384247No Hit
TACCCTGTAGATCCGGATTTGTG145440.16579989557707348No Hit
GTCTTTGCTGCGAGCC144630.1648765050695279No Hit
TCACAGTGAACCGGTCTCTTT144360.16456870823367936No Hit
ACAGTAGTCTGCACATTGGTTA140300.15994035581314225No Hit
GAAGGATCATTA135140.1540580162835926No Hit
TTCACAGTGGCTAAGTTCTGCT130590.14887106960540444No Hit
TGTAACAGCAACTCCATGTGGA130110.14832387523056262No Hit
TACCCTGTAGAACCGAATTTGT129810.1479818787462865No Hit
TTCACAGTGGTTAAGTTCTGCC128520.14651129386389908No Hit
AACTGGACAACTCTTAGCGG127870.14577030148130077No Hit
TGAGGTAGTTGTTTGTACAGTT124060.14142694613099377No Hit
ATGACCTATGAATTGACAGCCT123130.14036675702973775No Hit
TACAGTACTGTGATAACTGAAG121810.1388619724989227No Hit
AATGACACGTTTTCTCCCGGATT121100.13805258081946917No Hit
TGTAAACATCCCCGACTGGA119010.13567000531234538No Hit
CGCCTGTCTGAGGGTCGCT114550.13058565757944007No Hit
CCTCGATCCAAGTTTTTGT113490.12937727000166438No Hit
TTTTGCAGAAACGTTTCAGATT113220.12906947316581585No Hit
TGGAGTGTGACAATGGTGTTT112570.12832848078321754No Hit
AAGCTGCCAGCTGAAGAACTGC108970.12422452297190384No Hit
TTTGTTCGTTCGGCTCGCGTT105420.12017756457463617No Hit
AACTCCAGTCACAGTCAAATCTCGTAT103240.11769239012222954TruSeq Adapter, Index 13 (96% over 27bp)
AACATTCATTGCTGTCGGTGGGT102490.11683739891153919No Hit
TGTAAACATCCTACACTCTCAGC100710.11480821977150074No Hit
AACAGTAAGAGTTTATGTGCTG99810.11378223031867232No Hit
AACATTCATTGCTGTCGGTGGG99500.11342883395158698No Hit
TAGCAGCACGTAAATATTGGAG99130.1130070382876464No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT99000.11285883981112675No Hit
AATTTTTGACGGTCTCTACGGGGACTG97560.11121725668660128No Hit
CTCGTACCGTGAGTAATAATGC97150.11074986149142386No Hit
TGAGGTAGTAAGTTGTGTTGTT96100.10955287379645737No Hit
AGCTACATCTGGCTACTGGGTCTC93010.10603031000841312No Hit
TATTGCACTTGTCCCGGCCTGTAA91860.10471932348535458No Hit
TCAGTGCATTACAGAACTTTGT91420.10421772864174957No Hit
GTACAGTACTATGATAACTGAA89970.10256474563441488No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC88440.10082056356460656No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCGACA152.8023514E-6374.1185623
ACATAGC201.888111E-8374.1185323
CGTATGC106450.0346.0025323
CAACCCG5400.0336.013923
TAACTGC4100.0333.0567623
GATTCCT63050.0324.2756323
GCTTCCT3150.0308.7962623
TAACTAA700.0293.950323
AATAACC2250.0274.353623
CGTATGG150.0013990053249.4123723
CATAGCT5600.0237.1644423
GTATGCC8100.0228.62823
CGTATTC100.0019087109224.8394322
ATAACTA6700.0214.7719922
ACAACCC13000.0211.0031422
TCGTATG107500.0207.2705822
CCCGCCT2750.0204.0646723
GGATTCC74400.0192.9569422
AAATAGC6100.0190.1258223
CCTAGCT304.455117E-5187.0592823