FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_10_JG60_3_AGTTCC_L005_R1_001_TRIMMED_prinseq_good_XXRg.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_10_JG60_3_AGTTCC_L005_R1_001_TRIMMED_prinseq_good_XXRg.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7666964
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT4782956.238388493802762No Hit
ATGACCTATGAATTGACAGCC4126405.38205213954311No Hit
ATGACCTATGAATTGACAGCCA3566244.651436996443442No Hit
CCTGTCTGAGGGTCGCT3127754.079515698782465No Hit
TGAGGTAGTAGGTTGTATAGTT2232612.91198706554511No Hit
AAGCTGCCAGCTGAAGAACTGT2007612.6185201860866965No Hit
TAGCTTATCAGACTGGTGTTGGC1783492.326201088201275No Hit
AACATTCAACGCTGTCGGTGAGT1357661.7707921936244906No Hit
AACATTCAACGCTGTCGGTGAG1285511.6766871476114928No Hit
TCAGTAACTGGAATCTGTCCCT1163151.5170933370757969No Hit
CTACGCCTGTCTGAGGGTCGCT1107441.4444309377218936No Hit
TATTGCACTTGTCCCGGCCTGT1104481.440570217885463No Hit
TGTAAACATCCTTGACTGGAAGCT1027831.3405958342832964No Hit
TGAGGTAGTAGTTTGTATAGTT738940.9637974040311131No Hit
CTGTCTGAGGGTCGCT653620.8525147633404826No Hit
TGGAGTGTGACAATGGTGTTTG592340.7725874283484311No Hit
TGTAAACATCCTACACTCTCAGCT582900.760274862383598No Hit
TGTCTGAGGGTCGCT506210.6602483068917501No Hit
TTCAAGTAATCCAGGATAGGTT469510.6123805981089777No Hit
TTCCAGTGATGACAGCCTATAATCTGACT460390.6004854072615967No Hit
TGAGATGAAGCACTGTAGCTC458320.5977855119705792No Hit
TAACGGAACCCATAATGCAGCTG444820.5801774992030744No Hit
ACAGTAGTCTGCACATTGGTT409530.5341488495315747No Hit
TCCAGTGATGACAGCCTATAATCTGACT364910.4759511065918661No Hit
AACATTCAACGCTGTCGGTGA361200.4711121638239073No Hit
TTCACAGTGGCTAAGTTCTGC354750.46269944661276613No Hit
TCAGTAACTGGAATCTGTCCCTGC353650.46126471964652505No Hit
TTCACAGTGGCTAAGTTCTG341310.44516969167978354No Hit
AACCCGTAGATCCGAACTTGTG341070.4448566603416946No Hit
TGTAAACATCCCCGACTGGAAGCT308120.40188006621656236No Hit
TTCACAGTGGTTAAGTTCTG302280.394262970323064No Hit
TACGCCTGTCTGAGGGTCGCT301240.39290650119134507No Hit
TGAGATGAAGCACTGTAGCTCT290330.37867661828071714No Hit
TGAGGTAGTAGGTTGTATAGTTT288400.3761593246035849No Hit
TCGTACCGTGAGTAATAATGCA285780.37274206582944697No Hit
CTGGACAACTCTTAGCGG279320.36431630564588535No Hit
GGACAACTCTTAGCGG267470.3488603833277423No Hit
CCACGTTCCCGTGG259980.33909119698488216No Hit
ATGACCTATGAATTGACAGCCAT258700.3374216965150743No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT258680.33739561057023354No Hit
TAGCTTATCAGACTGGTGTTGG257720.3361434852178776No Hit
CATTATTACTTTTGGTACGCG255830.33367836343042695No Hit
TGAGGTAGTAGTTTGTGCTGTT248050.32353093088737606No Hit
TGAGGTAGTAGGTTGTATAGT247080.32226576256259976No Hit
CATTGCACTTGTCTCGGTCTGA245640.3203875745340659No Hit
TCAGTAACTGGAATCTGTCCCTG239570.3124704902748989No Hit
TGGAGTGTGACAATGGTGTTTGT227960.29732759929484476No Hit
TTCAAGTAATCCAGGATAGGCTT219350.2860976000409028No Hit
TGAGGTAGTAGATTGAATAGTT219020.2856671819510304No Hit
TATTGCACTTGTCCCGGCCTGTT215850.2815325596937719No Hit
TTCAAGTAATCCAGGATAGGC215820.28149343077651073No Hit
ACTGGACAACTCTTAGCGG204360.2665461843827622No Hit
TGTAAACATCCTACACTCAGCT188060.24528613933755264No Hit
TGTAAACATCCCCGACTGGAAGC186470.24321230672271318No Hit
TGAGATGAAGCACTGTAGCT181670.2369516799609337No Hit
TGTAAACATCCTTGACTGGAAGC177050.2309258267027209No Hit
AACTCCAGTCACAGTTCCATCTCGTATGC174140.2271303217283921TruSeq Adapter, Index 14 (96% over 29bp)
AAGCTGCCAGCTGAAGAACT173910.22683033336272349No Hit
TGAGAACTGAATTCCATAGATGG156740.2044355497169414No Hit
ATGACCTATGAATTGACAGC154750.20183999820528703No Hit
ACAGTAGTCTGCACATTGGTTA153130.19972703667318642No Hit
TGGAGTGTGACAATGGTGTTT149480.1949663517397499No Hit
TACCCTGTAGAACCGAATTTGCG149170.19456201959471833No Hit
AACTGGACAACTCTTAGCGG148840.19413160150484599No Hit
TCGTACCGTGAGTAATAATGC146920.1916273508001342No Hit
CCTGTCTGAGGGTCGCTT145480.18974916277160034No Hit
TTCACAGTGGTTAAGTTCTGC142090.18532759512109356No Hit
TACCCTGTAGATCCGGATTTGT140250.18292768819574476No Hit
TGTAAACATCCCCGACTGGA134880.17592361200600393No Hit
TAGCTTATCAGACTGGTGTTGGCT134320.175193205550463No Hit
TATTGCACTTGTCCCGGCCTGTA131990.17215419297651585No Hit
TACCCTGTAGATCCGGATTTGTG131160.17107162626562483No Hit
AACTCCAGTCACAGTTCCATCT127430.16620659755282532TruSeq Adapter, Index 14 (95% over 22bp)
TGTAACAGCAACTCCATGTGGA125170.16325888578582082No Hit
TATTGCACTTGTCCCGGCCTGTAT124440.1623067487991335No Hit
TATTGCACTTGTCCCGGCCTGTTT124270.16208501826798719No Hit
TCACAGTGAACCGGTCTCTTT122200.15938512297696977No Hit
CCTCGATCCAAGTTTTTGT121820.15888949002499556No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT117480.15322883999455325No Hit
CGCCTGTCTGAGGGTCGCT111820.14584651760462158No Hit
TTTTGCAGAAACGTTTCAGATT111320.1451943689836029No Hit
ATGACCTATGAATTGACAGCCT109350.14262490341678924No Hit
TGAGGTAGTTGTTTGTACAGTT105740.13791639037303424No Hit
CCTCCTTGCTGAATGTCGAGAACTGAGC104120.13580342884093366No Hit
TGAGGTAGTAAGTTGTGTTGTT100850.13153837685947134No Hit
TACCCTGTAGAACCGAATTTGT100590.13119925957654166No Hit
GTCTTTGCTGCGAGCC96690.1261125003325958No Hit
TCCCTGAGACCCTAACTTGTGA96470.12582555493934755No Hit
TGTAAACATCCTACACTCTCAGC96400.12573425413240494No Hit
GTACAGTACTATGATAACTGAA95620.12471690228361579No Hit
TTCACAGTGGTTAAGTTCTGCC91570.11943449845336433No Hit
CAGTCGGTAGAGCATC91370.11917363900495685No Hit
TACAGTACTGTGATAACTGAAG90490.11802585743196393No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC90340.11783021284565832No Hit
AACATTCATTGCTGTCGGTGGG90300.11777804095597683No Hit
CTTTCAGTCGGATGTTTGCAGC89930.11729545097642301No Hit
TTCACAGTGGCTAAGTTCTGCT89090.1161998412931116No Hit
TACAGTACTATGATAACTGAAT87290.11385210625744428No Hit
GAGAGAGGCATGATCGTAGCGATA86590.1129390981880181No Hit
GAGAGAGGCATGATCGTAGCGATAACT86350.11262606684992914No Hit
TATTGCACTTGTCCCGGCCTGTAA83710.1091827221309504No Hit
AACATTCATTGCTGTCGGTGGGT79670.10391336127311933No Hit
TACCCTGTAGAACCGAATTTGC79230.10333947048662287No Hit
TCAGTGCATTACAGAACTTTGT78450.10232211863783369No Hit
CTCGATCCAAGTTTTTGT76760.1001178562987905No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAC151.0712974E-6475.905123
TAACTGC6600.0465.0890823
CAACCCG4850.0441.5614323
CGTATGC19050.0429.688623
GATTCCT31950.0387.27823
TAACTAA600.0356.9288323
AATAACC1750.0339.932223
CATAGCT2850.0325.6192623
GGGTATC156.8039726E-4317.2700523
ATATGCC100.0012260177260.6622
AGGCAAT201.14590875E-7260.6622
ATAACTA6950.0256.909522
GTACTCT8150.0248.1713623
ACAACCC11650.0246.1167322
ACTACCC200.0016102561237.9525523
TCGTATG19400.0234.4596422
TCTGACT99850.0217.5770423
GCATAGC6650.0217.543322
GGATTCC43200.0216.3115822
AAATAGC6450.0213.9728423