FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_10_JG62_3_ATGTCA_L004_R1_001_TRIMMED_prinseq_good_2hm3.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_10_JG62_3_ATGTCA_L004_R1_001_TRIMMED_prinseq_good_2hm3.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7774991
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC5237686.736573714361856No Hit
ATGACCTATGAATTGACAGCCA4805316.180470176750044No Hit
CCTGTCTGAGGGTCGCT4075195.241407996485141No Hit
TTCAAGTAATCCAGGATAGGCT3630524.669484504869524No Hit
TGAGGTAGTAGGTTGTATAGTT2709973.485495996072536No Hit
AAGCTGCCAGCTGAAGAACTGT1636162.1043882880378897No Hit
TAGCTTATCAGACTGGTGTTGGC1517161.9513334484888794No Hit
CTACGCCTGTCTGAGGGTCGCT1424661.8323622496797747No Hit
TCAGTAACTGGAATCTGTCCCT1368251.7598091110330547No Hit
TATTGCACTTGTCCCGGCCTGT1315401.6918347558215825No Hit
AACATTCAACGCTGTCGGTGAGT1263031.6244777646687951No Hit
AACATTCAACGCTGTCGGTGAG1235381.5889150225382898No Hit
TGTAAACATCCTTGACTGGAAGCT1068411.3741623623744388No Hit
CTGTCTGAGGGTCGCT948591.2200528592251747No Hit
TGAGGTAGTAGTTTGTATAGTT848941.0918855082919068No Hit
TGTCTGAGGGTCGCT824581.0605542823136387No Hit
TGTAAACATCCTACACTCTCAGCT650350.8364639907621757No Hit
TGGAGTGTGACAATGGTGTTTG572130.7358593726989523No Hit
TTCAAGTAATCCAGGATAGGTT541840.6969011282456791No Hit
TTCACAGTGGCTAAGTTCTGC512200.658778897621875No Hit
TTCACAGTGGCTAAGTTCTG494840.6364508974994312No Hit
TCAGTAACTGGAATCTGTCCCTGC478320.6152032844796862No Hit
TGAGATGAAGCACTGTAGCTC459260.5906887866493993No Hit
CCACGTTCCCGTGG450920.579962086129746No Hit
TACGCCTGTCTGAGGGTCGCT416750.5360134822021017No Hit
TGTAAACATCCCCGACTGGAAGCT401800.5167851641243058No Hit
ACAGTAGTCTGCACATTGGTT384040.4939426939529576No Hit
CTGGACAACTCTTAGCGG367490.4726564956795448No Hit
TTCACAGTGGTTAAGTTCTG365750.4704185509668114No Hit
GGACAACTCTTAGCGG362290.46596838504378973No Hit
AACTCCAGTCACATGTCAATCT332620.427807569166318TruSeq Adapter, Index 15 (95% over 22bp)
AACCCGTAGATCCGAACTTGTG318240.4093123709082107No Hit
TCAGTAACTGGAATCTGTCCCTG316750.40739596997604244No Hit
TGAGGTAGTAGATTGAATAGTT309500.39807120033965315No Hit
TGAGATGAAGCACTGTAGCTCT296720.3816338822771628No Hit
TGAGGTAGTAGGTTGTATAGTTT279020.3588685826131503No Hit
ATGACCTATGAATTGACAGCCAT278210.3578267807641192No Hit
CATTGCACTTGTCTCGGTCTGA271170.3487721079034046No Hit
CATTATTACTTTTGGTACGCG263300.3386499096912138No Hit
TGAGGTAGTAGGTTGTATAGT259950.33434122303164077No Hit
TCGTACCGTGAGTAATAATGCA254220.3269714395810876No Hit
ACTGGACAACTCTTAGCGG254020.3267142045566355No Hit
TAGCTTATCAGACTGGTGTTGG238350.306559840390812No Hit
AACATTCAACGCTGTCGGTGA229870.2956530753540422No Hit
TTCCAGTGATGACAGCCTATAATCTGACT221460.2848363425758306No Hit
AACTCCAGTCACATGTCAATCTC215590.27728649460816096TruSeq Adapter, Index 15 (95% over 23bp)
TCCCATATGGTCTAGCGGTTAGGATTCCT214650.276077489993236No Hit
TATTGCACTTGTCCCGGCCTGTT206990.2662253885567199No Hit
TGAGGTAGTAGTTTGTGCTGTT201350.2589713608671701No Hit
TGTAAACATCCTACACTCAGCT198550.25537007052484045No Hit
TGGAGTGTGACAATGGTGTTTGT196920.25327360507555574No Hit
AACTCCAGTCACATGTCAATCTCG191460.24625108890801287TruSeq Adapter, Index 15 (95% over 24bp)
AACTGGACAACTCTTAGCGG186010.23924143449169263No Hit
AACTCCAGTCACATGTCAATCTCGTATGC184740.2376079920864217TruSeq Adapter, Index 15 (96% over 29bp)
GAAGGATCATTA181240.23310637915850965No Hit
TTCACAGTGGTTAAGTTCTGC179110.2303668261480946No Hit
TCGTACCGTGAGTAATAATGC174840.22487485837604185No Hit
ATGACCTATGAATTGACAGC169060.21744076616937563No Hit
TGTAAACATCCCCGACTGGAAGC168700.21697774312536183No Hit
TAACGGAACCCATAATGCAGCTG165780.2132221117683609No Hit
TGAGATGAAGCACTGTAGCT158190.203460042590403No Hit
TTCAAGTAATCCAGGATAGGC157260.20226389972670067No Hit
ACAGTAGTCTGCACATTGGTTA155700.20025746653597412No Hit
TCCAGTGATGACAGCCTATAATCTGACT154930.19926711169183345No Hit
CCTGTCTGAGGGTCGCTT147800.19009668307011546No Hit
CGCCTGTCTGAGGGTCGCT146930.18897771071374872No Hit
TGAGAACTGAATTCCATAGATGG146230.18807738812816632No Hit
TGTAAACATCCTTGACTGGAAGC144240.18551789963486776No Hit
TTTTGCAGAAACGTTTCAGATT142990.18391018073204202No Hit
AAGCTGCCAGCTGAAGAACT142260.18297127289279178No Hit
CAGTCGGTAGAGCATC141490.1819809180486511No Hit
TTCAAGTAATCCAGGATAGGCTT136170.17513846639822478No Hit
CCTCGATCCAAGTTTTTGT134710.1732606507197243No Hit
TTCACAGTGGTTAAGTTCTGCC132310.17017383042629888No Hit
AAGTTCTGTGATACACTCAGACT132090.16989087189940155No Hit
TGAGGTAGTAAGTTGTGTTGTT131500.1691320285772678No Hit
TATTGCACTTGTCCCGGCCTGTA128520.16529922671293124No Hit
TACCCTGTAGAACCGAATTTGCG126020.16208378890727976No Hit
TGGAGTGTGACAATGGTGTTT125630.16158218060959814No Hit
TGTAACAGCAACTCCATGTGGA124090.15960147092131682No Hit
TGAGGTAGTTGTTTGTACAGTT123020.15822526354049798No Hit
TCACAGTGAACCGGTCTCTTT116140.1493763786993451No Hit
TTTGTTCGTTCGGCTCGCGTTA115990.14918345243100603No Hit
TGTAAACATCCCCGACTGGA111690.14365289940528547No Hit
AAACCGTTACCATTACTGAGTTT111560.1434856966393916No Hit
TTCACAGTGGCTAAGTTCTGCT111120.14291977958559696No Hit
TATTGCACTTGTCCCGGCCTGTTT110820.14253392704891876No Hit
ATGACCTATGAATTGACAGCCT110070.14156929570722332No Hit
TGAGGTAGTAGGTTGTGTGGTT107030.13765932333555114No Hit
TATTGCACTTGTCCCGGCCTGTAT106820.1373892265598764No Hit
TGAGGTAGTTGGTTGTATTGTT106580.13708054453053387No Hit
TACCCTGTAGAACCGAATTTGT102390.131691470768262No Hit
TACCCTGTAGATCCGGATTTGT102240.1314985444999229No Hit
CTCGATCCAAGTTTTTGT101800.1309326274461282No Hit
TAGCAGCACGTAAATATTGGAG100870.12973648458242587No Hit
TGGACAACTCTTAGCGG100060.1286946827333948No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT99320.12774291314292197No Hit
TACAGTACTGTGATAACTGAAG98590.12680400530367175No Hit
TGTAAACATCCTACACTCTCAGC97950.12598085322542496No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC97730.12569789469852763No Hit
TAGCTTATCAGACTGGTGTTGGCT97370.1252348716545138No Hit
AACATTCATTGCTGTCGGTGGG93510.12027023568258793No Hit
TCCCTGAGACCCTAACTTGTGA93130.1197814891361289No Hit
AGCTACATCTGGCTACTGGGTCTC92180.11855962276998133No Hit
TGAGGTAGTTAGTTGTGTTGTT91950.1182638024918614No Hit
TCAGTGCATTACAGAACTTTGT88750.1141480421006275No Hit
AACAGTAAGAGTTTATGTGCTG88330.11360784854927805No Hit
AACTCCAGTCACATGTCAATCTCGTAT87980.11315768725648685TruSeq Adapter, Index 15 (96% over 27bp)
TTTGTTCGTTCGGCTCGCGTT87230.11219305591479141No Hit
GAGAGAGGCATGATCGTAGCGATA86000.11061106051441089No Hit
CTCGTACCGTGAGTAATAATGC84380.10852745681634872No Hit
GTCTGAGGGTCGCT83920.10793581626010885No Hit
GCTACGCCTGTCTGAGGGTCGCT81790.10519626324969379No Hit
TATTGCACTTGTCCCGGCCTGTAA81030.10421877015677575No Hit
TGTGCAAATCCATGCAAAACTG80820.10394867338110103No Hit
CACGTTCCCGTGG80620.1036914383566489No Hit
AAGGTCCAACCTCACATGTCCT79430.1021608899611588No Hit
AACATTCATTGCTGTCGGTGGGT79010.10162069640980934No Hit
AAGTTCTGTGATACACTTTGACT78690.10120912037068597No Hit
TCTACAGTGCATGTGTCTCCAGT78290.10069465032178171No Hit
CTTTCAGTCGGATGTTTGCAGC78010.10033452128754876No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC27950.0613.0625623
CAACCCG3300.0585.7644723
TAACTGC3650.0583.452423
GATTCCT25350.0545.405423
AATAACC1650.0516.2669723
TAACTAA1100.0476.554123
CCCGCCT3050.0386.7119423
TCTCGCC8100.0384.2585423
ATAACTA7100.0353.809122
TCGTATG28850.0341.9347522
ACAACCC9000.0336.1616822
AGCATGC403.6559868E-8327.6309523
GGATTCC36300.0311.1579622
CATAGCT2550.0308.3585223
TCTGACT48850.0292.4198323
TAATAAC2450.0291.8806522
GACCACC456.580012E-8291.227523
ATATGAC209.570082E-6275.041422
AGGCAAT209.570082E-6275.041422
TTACTTC100.0011045027269.9049721