FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_12_JG10_3_GTAGAG_L007_R1_001_TRIMMED_prinseq_good_ysgY.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_12_JG10_3_GTAGAG_L007_R1_001_TRIMMED_prinseq_good_ysgY.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6894928
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT4734136.866105055774331No Hit
ATGACCTATGAATTGACAGCC4059435.88755966704801No Hit
ATGACCTATGAATTGACAGCCA3584575.198850517365808No Hit
CCTGTCTGAGGGTCGCT3405204.93870276817974No Hit
TGAGGTAGTAGGTTGTATAGTT2229063.23289815354127No Hit
TCAGTAACTGGAATCTGTCCCT1818092.636851320274846No Hit
AAGCTGCCAGCTGAAGAACTGT1520722.2055632778181296No Hit
TAGCTTATCAGACTGGTGTTGGC1244791.805370556443809No Hit
TATTGCACTTGTCCCGGCCTGT1106301.6045127664857415No Hit
CTACGCCTGTCTGAGGGTCGCT1045281.516012930084259No Hit
AACATTCAACGCTGTCGGTGAG904961.312501015239028No Hit
AACATTCAACGCTGTCGGTGAGT900181.3055683830200984No Hit
CTGTCTGAGGGTCGCT784841.138285998055382No Hit
TGAGGTAGTAGTTTGTATAGTT711391.031758417201746No Hit
TGTAAACATCCTTGACTGGAAGCT705381.0230418649766901No Hit
TGTCTGAGGGTCGCT606970.8803137610719068No Hit
TTCAAGTAATCCAGGATAGGTT537020.7788623753576542No Hit
TTCACAGTGGCTAAGTTCTG465880.6756850832960113No Hit
TGTAAACATCCTACACTCTCAGCT454790.659600796411507No Hit
TGGAGTGTGACAATGGTGTTTG454410.6590496666535169No Hit
TGAGATGAAGCACTGTAGCTC425970.617801955292354No Hit
ACAGTAGTCTGCACATTGGTT415420.6025008528007834No Hit
TCAGTAACTGGAATCTGTCCCTGC404700.5869531922595856No Hit
ATGACCTATGAATTGACAGCCAT385590.5592371667985511No Hit
TTCCAGTGATGACAGCCTATAATCTGACT384930.5582799414294101No Hit
TTCACAGTGGCTAAGTTCTGC383380.5560319121533974No Hit
TGAGATGAAGCACTGTAGCTCT350910.5089393246746013No Hit
CCACGTTCCCGTGG348700.5057340700294477No Hit
TCCAGTGATGACAGCCTATAATCTGACT329560.4779745343243613No Hit
CTGGACAACTCTTAGCGG325240.47170905918089356No Hit
TGAGGTAGTAGGTTGTATAGTTT323700.46947553331956476No Hit
GGACAACTCTTAGCGG314640.4563354396159031No Hit
TTCACAGTGGTTAAGTTCTG309450.44880816739493146No Hit
CCTGTCTGAGGGTCGCTT307700.4462700698252397No Hit
AACTCCAGTCACGTAGAGATCT303350.43996108443772003RNA PCR Primer, Index 17 (100% over 22bp)
TTCAAGTAATCCAGGATAGGCTT300770.4362192034492601No Hit
TGAGGTAGTAGGTTGTATAGT296830.4305048580637826No Hit
TACGCCTGTCTGAGGGTCGCT281250.40790853798618343No Hit
TCAGTAACTGGAATCTGTCCCTG281060.4076329731071884No Hit
AACCCGTAGATCCGAACTTGTG247440.3588724929397377No Hit
CATTGCACTTGTCTCGGTCTGA245280.35573975536800384No Hit
TGTAAACATCCCCGACTGGAAGCT237770.344847690940355No Hit
TATTGCACTTGTCCCGGCCTGTT236530.3430492675195448No Hit
AACATTCAACGCTGTCGGTGA232770.3375959835983784No Hit
TTTGTTCGTTCGGCTCGCGTTA232620.3373784323781191No Hit
TTCAAGTAATCCAGGATAGGC225230.3266604089266777No Hit
TGAGGTAGTAGATTGAATAGTT221420.32113460793209153No Hit
ACTGGACAACTCTTAGCGG217490.31543476596129794No Hit
TGGAGTGTGACAATGGTGTTTGT214700.31138831326447497No Hit
CATTATTACTTTTGGTACGCG211810.3071968264208125No Hit
AACTCCAGTCACGTAGAGATCTCGTATGC205870.2985817980985443RNA PCR Primer, Index 17 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTT202010.2929834800305384No Hit
ATGACCTATGAATTGACAGC200590.29092399514541706No Hit
TAACGGAACCCATAATGCAGCTG196130.2844554721963739No Hit
TGAGATGAAGCACTGTAGCT179220.2599301979658091No Hit
TTTGTTCGTTCGGCTCGCGTT176680.25624633063608493No Hit
TGTAAACATCCTACACTCAGCT168370.24419399303371986No Hit
TCGTACCGTGAGTAATAATGCA167590.2430627266883715No Hit
AAGCTGCCAGCTGAAGAACT166330.24123529643819341No Hit
TATTGCACTTGTCCCGGCCTGTAT161260.23388206519342913No Hit
AACTCCAGTCACGTAGAGATCTC159720.23164853933210033RNA PCR Primer, Index 17 (100% over 23bp)
AACTGGACAACTCTTAGCGG153790.2230480144245161No Hit
TAGCTTATCAGACTGGTGTTGG153030.2219457549085357No Hit
TGGAGTGTGACAATGGTGTTT152410.22104654319813058No Hit
TGTAAACATCCCCGACTGGAAGC151320.21946567099757966No Hit
TATTGCACTTGTCCCGGCCTGTA146670.21272158316954143No Hit
TCGTACCGTGAGTAATAATGC146500.2124750251199142No Hit
TGTAAACATCCCCGACTGGA146220.21206892950876355No Hit
ATGACCTATGAATTGACAGCCT145200.21058958121100033No Hit
TCACAGTGAACCGGTCTCTTT144580.20969036950059522No Hit
TGTAAACATCCTTGACTGGAAGC143730.2084575792524592No Hit
ACAGTAGTCTGCACATTGGTTA139510.20233713825583097No Hit
TATTGCACTTGTCCCGGCCTGTTT137480.19939294507498848No Hit
CAGTCGGTAGAGCATC131990.19143057041349815No Hit
AACTCCAGTCACGTAGAGATCTCG129650.1880367713774531RNA PCR Primer, Index 17 (100% over 24bp)
TACCCTGTAGATCCGGATTTGT127940.18555668746649712No Hit
TGTAACAGCAACTCCATGTGGA124750.18093009818231606No Hit
TTCACAGTGGTTAAGTTCTGC122860.17818895280704888No Hit
GAAGGATCATTA116900.1695449176554128No Hit
TGAGGTAGTTGTTTGTACAGTT114260.16571601617884915No Hit
TTCACAGTGGCTAAGTTCTGCT114000.16533892739706635No Hit
CGCCTGTCTGAGGGTCGCT112410.1630328844623178No Hit
TTTTGCAGAAACGTTTCAGATT110750.16062531762478158No Hit
TGAGAACTGAATTCCATAGATGG107390.15575217029097332No Hit
TATTGCACTTGTCCCGGCCTGTAA102220.14825390489936952No Hit
AGCTACATCTGGCTACTGGGTCTC100670.14600587562335676No Hit
TAGCTTATCAGACTGGTGTTGGCT96560.140044972188252No Hit
AACTCCAGTCACGTAGAGATCTCGTAT95740.13885569218416785RNA PCR Primer, Index 17 (100% over 27bp)
TACAGTACTGTGATAACTGAAG93930.13623057412637232No Hit
TGAGGTAGTAAGTTGTGTTGTT92190.13370697997136446No Hit
TACCCTGTAGAACCGAATTTGT91390.1325467067966482No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT91140.13218412142954938No Hit
TACAGTACTATGATAACTGAAT86230.12506294481972835No Hit
TACCCTGTAGATCCGGATTTGTG85120.12345306578980955No Hit
TGAGGTAGTTGGTTGTATAGTT84420.12243782676193284No Hit
CTACGCCTGTCTGAGGGTCGCTT84380.12237981310319701No Hit
TACAGTACTATGATAACTGAA81630.11839137406510988No Hit
TGTAAACATCCTACACTCTCAGC81380.11802878869801106No Hit
GTACAGTACTATGATAACTGAA79870.11583877308073413No Hit
TTCACAGTGGTTAAGTTCTGCC79740.11565022868984273No Hit
TCCCTGAGACCCTAACTTGTGA79420.11518611941995624No Hit
CACGTTCCCGTGG79090.11470750673538577No Hit
TCGGTAGAGCATGAGACT77310.11212589892164213No Hit
AACAGTAAGAGTTTATGTGCTG76320.11069006086793076No Hit
TGAGGTAGTAGGTTGTGTGGTT74830.10852905208002173No Hit
TCGGTAGAGCATGAGAC74530.10809394963950311No Hit
TGGACAACTCTTAGCGG74040.10738328231998942No Hit
TGAGGTAGTAGTTTGTATAGT70580.10236510083934161No Hit
GCTACGCCTGTCTGAGGGTCGCT69290.10049416034511166No Hit
CTTTCAGTCGGATGTTTGCAGC69210.10037813302764002No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA850.0640.0758723
TAACTGC2000.0629.0746523
CGTATGC31550.0589.5469423
CAACCCG1750.0544.064523
AATAACC1350.0503.7634323
GATTCCT11400.0492.163623
CATAGCT1350.0478.5752623
TAACTAC152.3339716E-4453.3871223
ATCACTA103.4284283E-4398.8365822
ATATGAC300.0398.8365522
ATAACTA5850.0392.0188322
AAATAGC2000.0391.046423
ACAACCC6000.0382.2183522
TCGTATG32900.0341.2537522
CTTCACA107.627557E-4305.4106821
AGGCTTC156.3004136E-6305.4106821
TCTGACT85950.0303.049323
GCATAGC2950.0297.437422
TAATAAC2150.0296.808622
GACAACC10800.0295.5131221