FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_12_JG11_3_GTCCGC_L006_R1_001_TRIMMED_prinseq_good_rdWR.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_12_JG11_3_GTCCGC_L006_R1_001_TRIMMED_prinseq_good_rdWR.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5287151
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC4086907.729871910221592No Hit
TTCAAGTAATCCAGGATAGGCT3446916.51940903522521No Hit
ATGACCTATGAATTGACAGCCA3082165.829528984513588No Hit
CCTGTCTGAGGGTCGCT2148804.064192605809821No Hit
TGAGGTAGTAGGTTGTATAGTT1807953.419516484397741No Hit
AAGCTGCCAGCTGAAGAACTGT1340562.5355054168114357No Hit
AACATTCAACGCTGTCGGTGAG1125292.1283485188904194No Hit
TCAGTAACTGGAATCTGTCCCT1106422.0926582198995263No Hit
AACATTCAACGCTGTCGGTGAGT1029701.9475517154702031No Hit
CTACGCCTGTCTGAGGGTCGCT781921.4789061254350404No Hit
TAGCTTATCAGACTGGTGTTGGC759121.4357827117099549No Hit
TATTGCACTTGTCCCGGCCTGT717591.3572337918852706No Hit
TGTAAACATCCTTGACTGGAAGCT598221.131460024500908No Hit
TGAGGTAGTAGTTTGTATAGTT578071.0933487619324662No Hit
TTCCAGTGATGACAGCCTATAATCTGACT516330.9765750968716421No Hit
CTGTCTGAGGGTCGCT479710.9073128420202109No Hit
TCCAGTGATGACAGCCTATAATCTGACT435650.8239787363742779No Hit
TGTCTGAGGGTCGCT389760.7371834093635684No Hit
TTCAAGTAATCCAGGATAGGTT384540.7273104172738777No Hit
TGGAGTGTGACAATGGTGTTTG366830.693814116525138No Hit
TGTAAACATCCTACACTCTCAGCT328160.6206745371940389No Hit
AACCCGTAGATCCGAACTTGTG295780.5594317241932375No Hit
TTCACAGTGGCTAAGTTCTG294510.5570296743936385No Hit
TTCACAGTGGCTAAGTTCTGC275860.5217554785176364No Hit
ACAGTAGTCTGCACATTGGTT269130.5090265059575563No Hit
TCAGTAACTGGAATCTGTCCCTGC265570.5022932010074991No Hit
ATGACCTATGAATTGACAGCCAT263350.4980943423026882No Hit
TGAGGTAGTAGGTTGTATAGTTT262130.49578686139283706No Hit
AACATTCAACGCTGTCGGTGA251290.47528432609547183No Hit
TGAGATGAAGCACTGTAGCTC250230.4732794656328143No Hit
TGAGGTAGTAGGTTGTATAGT240840.45551942813814095No Hit
TTCACAGTGGTTAAGTTCTG219790.41570592555423513No Hit
AACTCCAGTCACGTCCGCATCT218950.4141171682064688TruSeq Adapter, Index 18 (100% over 22bp)
CTGGACAACTCTTAGCGG215720.4080080179287484No Hit
TACGCCTGTCTGAGGGTCGCT212060.4010855751991952No Hit
TGTAAACATCCCCGACTGGAAGCT211770.4005370756386568No Hit
GGACAACTCTTAGCGG194650.3681566877889434No Hit
TGAGGTAGTAGTTTGTGCTGTT191630.36244472684816453No Hit
AACTCCAGTCACGTCCGCATCTCGTATGC190210.35975897037932153TruSeq Adapter, Index 18 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCT182500.34517644758018073No Hit
TTCAAGTAATCCAGGATAGGCTT182030.34428750001654956No Hit
TCAGTAACTGGAATCTGTCCCTG179110.3387646768552667No Hit
CCTGTCTGAGGGTCGCTT165620.31324999040125767No Hit
TTCAAGTAATCCAGGATAGGC165330.3127014908407193No Hit
CATTATTACTTTTGGTACGCG165020.3121151637242818No Hit
CATTGCACTTGTCTCGGTCTGA163840.3098833379262291No Hit
CCACGTTCCCGTGG161860.3061384098922085No Hit
ATGACCTATGAATTGACAGC156780.29653021069381225No Hit
TATTGCACTTGTCCCGGCCTGTT150620.2848793234768593No Hit
TCGTACCGTGAGTAATAATGCA150300.2842740825824721No Hit
ACTGGACAACTCTTAGCGG149530.28281772168035296No Hit
TGGAGTGTGACAATGGTGTTTGT144600.2734932291512007No Hit
TCGTACCGTGAGTAATAATGC144380.27307712603630957No Hit
AAGCTGCCAGCTGAAGAACT140290.2653413908549236No Hit
TATTGCACTTGTCCCGGCCTGTAT128680.2433824946554392No Hit
TGTAAACATCCTACACTCAGCT127160.24050760040710017No Hit
TGAGGTAGTAGATTGAATAGTT124700.23585481103149883No Hit
ATGACCTATGAATTGACAGCCT124650.23576024214175084No Hit
TATTGCACTTGTCCCGGCCTGTA121590.22997262608917354No Hit
AACTCCAGTCACGTCCGCATCTC121380.22957543675223196TruSeq Adapter, Index 18 (100% over 23bp)
TGAGGTAGTTGGTTGTATAGTT118490.22410935492479786No Hit
TGTAAACATCCCCGACTGGA116120.2196267895507429No Hit
TAGCTTATCAGACTGGTGTTGG113160.21402831127766164No Hit
TGAGATGAAGCACTGTAGCT112650.21306370860223212No Hit
TACCCTGTAGATCCGGATTTGT110250.20852440189432836No Hit
TGTAAACATCCCCGACTGGAAGC109840.2077489369983948No Hit
AACTGGACAACTCTTAGCGG105370.19929447825492408No Hit
AACTCCAGTCACGTCCGCATCTCG104550.19774354846305697TruSeq Adapter, Index 18 (100% over 24bp)
TGTAAACATCCTTGACTGGAAGC101580.19212615641202604No Hit
ACAGTAGTCTGCACATTGGTTA101170.19135069151609252No Hit
TGGAGTGTGACAATGGTGTTT99290.1877949012615679No Hit
AACTCCAGTCACGTCCGCATCTCGTAT97000.18346364611110974TruSeq Adapter, Index 18 (100% over 27bp)
TACCCTGTAGAACCGAATTTGT93090.17606835893281655No Hit
TTTTGCAGAAACGTTTCAGATT92480.17491461847789103No Hit
TACCCTGTAGAACCGAATTTGCG92180.17434720513940305No Hit
TATTGCACTTGTCCCGGCCTGTAA92080.17415806735990705No Hit
TGTAACAGCAACTCCATGTGGA91910.17383653313476388No Hit
TATTGCACTTGTCCCGGCCTGTTT89480.16924048509301134No Hit
TCCCTGAGACCCTAACTTGTGA87110.1647579197189564No Hit
TTCACAGTGGTTAAGTTCTGC85230.1612021294644318No Hit
AAGAATGATGTATACTCTTTAATCTGAGA83840.15857311432943755No Hit
AAGTTCTGTGATACACTCAGACT76910.14546586621036547No Hit
TCCCTGAGACCCTTAACCTGTGA75710.1431962128564136No Hit
TGAGGTAGTAAGTTGTGTTGTT75710.1431962128564136No Hit
TGAGGTAGTTGTTTGTACAGTT75270.14236400662663123No Hit
CGCCTGTCTGAGGGTCGCT74680.1412480937276049No Hit
TCACAGTGAACCGGTCTCTTT73500.13901626792955224No Hit
TACGACCTCAGATCAGACGAGA73140.13833537192336667No Hit
TACAGTACTGTGATAACTGAAG72630.13737076924793712No Hit
TGAGGTAGTAGGTTGTGTGGTT72350.13684118346534835No Hit
CCTCCTTGCTGAATGTCGAGAACTGAGC69780.13198034253230143No Hit
AAACCGTTACCATTACTGAGTTT69710.13184794608665423No Hit
TTCACAGTGGCTAAGTTCTGCT69380.13122379141431748No Hit
TCAGTGCATTACAGAACTTTGT67440.1275545184920953No Hit
TACCCTGTAGATCCGGATTTGTG67240.12717624293310328No Hit
CAAGCTCGTATCTATAGGTATG65220.1233556597872843No Hit
GAAGGATCATTA65170.12326109089753631No Hit
TACGACCTCAGATCAGACGAGAC64670.12231540200005636No Hit
TGCCTGTGATGAGACTCTCGACG64130.12129405799077803No Hit
AGCTACATCTGGCTACTGGGTCTC63470.12004574864610448No Hit
AACCCGTAGATCCGAACTTGT62400.1180219744054974No Hit
GGAATACCAGGTGCTGTAAGCTT62100.11745456106700942No Hit
TGTGCAAATCCATGCAAAACTG62060.11737890595521104No Hit
TTTGTTCGTTCGGCTCGCGTTA61180.11571449349564633No Hit
TCCCTGAGACCCTTAACCTGTG60170.11380420192273683No Hit
TAGCTTATCAGACTGGTGTTGGCT59930.11335027125194647No Hit
CTACGCCTGTCTGAGGGTCGCTT58940.11147780723493617No Hit
TACAGTACTATGATAACTGAA58840.11128866945544018No Hit
TGAGGTAGTAGTTTGTATAGT57760.1092459814368835No Hit
TACGACCTCAGATCAGA57590.10892444721174031No Hit
TGTAAACATCCTACACTCTCAGC56940.10769505164501637No Hit
GTACAGTACTGTGATAACTGA55760.1054632258469637No Hit
TACAGTACTATGATAACTGAAT55230.10446079561563495No Hit
AGAGATGATGAC55010.10404469250074379No Hit
GCTACGCCTGTCTGAGGGTCGCT54690.10343945160635662No Hit
CTTCATGATGATCTCAAGAGTTCTGACA54480.10304226226941504No Hit
TGGACAACTCTTAGCGG53790.1017372115908927No Hit
CTCGTACCGTGAGTAATAATGC53600.10137784980985033No Hit
GTACAGTACTATGATAACTGAA53350.10090500536111037No Hit
AACATTCATTGCTGTCGGTGGG53280.10077260891546316No Hit
ATAGCTCTTTAAATGGTACTGC53260.10073478135956397No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA650.0526.1499623
CGTATGC21200.0517.5669623
TAACTGC1300.0504.2270823
AATAACC1300.0438.458323
CAACCCG700.0407.1398623
GATTCCT2850.0369.9972823
GGGGAAA106.4869184E-4322.3655722
ATAACTA4050.0318.3857422
ACAACCC5500.0310.6431622
TATGCCG1600.0302.810323
AAATAGC2400.0296.8728323
TCGTATG22200.0290.419422
TCTGACG209.3777705E-4284.9979223
GGCGCCC308.294179E-6284.9979223
TCTGACT108500.0279.2191823
ATCACTA251.2074997E-7257.8924622
GCTCACT151.3380986E-5252.8842621
TTCAGCT100.0013422052252.8842521
CTTCACC100.0013422052252.8842521
CGTTAGA201.3321187E-7252.8842521