FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_12_JG13_3_GTGAAA_L005_R1_001_TRIMMED_prinseq_good_6oCx.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_12_JG13_3_GTGAAA_L005_R1_001_TRIMMED_prinseq_good_6oCx.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5702003
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT4400987.718305304293947No Hit
ATGACCTATGAATTGACAGCC4183937.3376495943618405No Hit
ATGACCTATGAATTGACAGCCA3118365.468885232084234No Hit
CCTGTCTGAGGGTCGCT2447704.292702055751286No Hit
TGAGGTAGTAGGTTGTATAGTT2428354.258766612364111No Hit
AAGCTGCCAGCTGAAGAACTGT1369142.4011562252773277No Hit
AACATTCAACGCTGTCGGTGAG1033421.8123806669340583No Hit
AACATTCAACGCTGTCGGTGAGT1028051.8029629237304854No Hit
TGAGGTAGTAGTTTGTATAGTT831661.458540095471714No Hit
TCAGTAACTGGAATCTGTCCCT807931.4169231408682177No Hit
TAGCTTATCAGACTGGTGTTGGC803211.4086453479593048No Hit
CTACGCCTGTCTGAGGGTCGCT796151.3962637339896173No Hit
TATTGCACTTGTCCCGGCCTGT719891.2625212578807834No Hit
TGTAAACATCCTTGACTGGAAGCT675331.1843732807576566No Hit
TGGAGTGTGACAATGGTGTTTG531950.9329177834525868No Hit
CTGTCTGAGGGTCGCT525580.9217462705649225No Hit
TTCAAGTAATCCAGGATAGGTT476820.8362324607686106No Hit
TTCCAGTGATGACAGCCTATAATCTGACT461200.808838578303098No Hit
TGTCTGAGGGTCGCT447790.7853205268394281No Hit
TGTAAACATCCTACACTCTCAGCT381530.6691157475715113No Hit
TGAGATGAAGCACTGTAGCTC380570.6674321286747833No Hit
TCCAGTGATGACAGCCTATAATCTGACT372620.6534896596862542No Hit
TTCACAGTGGCTAAGTTCTG355030.6226408509430809No Hit
TGAGGTAGTAGGTTGTATAGTTT343950.6032090828433447No Hit
TGAGATGAAGCACTGTAGCTCT333570.5850049535224727No Hit
TGAGGTAGTAGGTTGTATAGT326400.5724304248875351No Hit
CCACGTTCCCGTGG323870.5679933875867831No Hit
TTCACAGTGGCTAAGTTCTGC321010.5629776062902808No Hit
ACAGTAGTCTGCACATTGGTT317490.5568043370022779No Hit
CTGGACAACTCTTAGCGG291240.5107678827948705No Hit
TTCACAGTGGTTAAGTTCTG283890.4978776756167964No Hit
GGACAACTCTTAGCGG256680.4501576025126609No Hit
AACATTCAACGCTGTCGGTGA252220.44233578972161186No Hit
TGTAAACATCCCCGACTGGAAGCT251030.4402488037975427No Hit
AACCCGTAGATCCGAACTTGTG247570.4341807606905854No Hit
ATGACCTATGAATTGACAGCCAT236820.4153277365865995No Hit
AACTCCAGTCACGTGAAAATCTCGTATGC235130.41236386582048445TruSeq Adapter, Index 19 (96% over 29bp)
TACGCCTGTCTGAGGGTCGCT224870.3943701888617035No Hit
TGAGATGAAGCACTGTAGCT224640.3939668218343624No Hit
CATTATTACTTTTGGTACGCG221970.38928425677783757No Hit
TTCAAGTAATCCAGGATAGGCTT204830.35922464439250557No Hit
ACTGGACAACTCTTAGCGG204570.3587686642746417No Hit
TTCAAGTAATCCAGGATAGGC203330.35659398986636803No Hit
TCAGTAACTGGAATCTGTCCCTGC190870.33474201960258526No Hit
TGAGGTAGTAGTTTGTGCTGTT182290.31969467571307836No Hit
CATTGCACTTGTCTCGGTCTGA178710.31341618024403No Hit
TCGTACCGTGAGTAATAATGCA174950.3068220062318452No Hit
TGGAGTGTGACAATGGTGTTTGT170230.2985442133229323No Hit
ATGACCTATGAATTGACAGC163290.28637305171533584No Hit
CCTGTCTGAGGGTCGCTT163090.2860222977785175No Hit
TGTAAACATCCCCGACTGGA156790.27497354876873964No Hit
AAGCTGCCAGCTGAAGAACT155630.27293917593519335No Hit
TGTAAACATCCTACACTCAGCT149770.26266208558641585No Hit
TGTAAACATCCCCGACTGGAAGC143270.2512625826398197No Hit
TGAGGTAGTAGATTGAATAGTT143220.25117489415561517No Hit
AACTGGACAACTCTTAGCGG142860.2505435370693421No Hit
ATGACCTATGAATTGACAGCCT141460.24808825951161373No Hit
TATTGCACTTGTCCCGGCCTGTT139980.24549268037915797No Hit
AACTCCAGTCACGTGAAAATCT130280.22848111444346836TruSeq Adapter, Index 19 (95% over 22bp)
TGGAGTGTGACAATGGTGTTT124480.21830925027573644No Hit
AAACCGTTACCATTACTGAGTTT121550.21317070510134772No Hit
ACAGTAGTCTGCACATTGGTTA121480.2130479412234613No Hit
TAGCTTATCAGACTGGTGTTGG121390.21289010195189306No Hit
TATTGCACTTGTCCCGGCCTGTAT120280.21094341760255125No Hit
TCAGTAACTGGAATCTGTCCCTG120130.2106803521499375No Hit
TACCCTGTAGATCCGGATTTGT118180.20726050126595863No Hit
TGGACAACTCTTAGCGG113030.19822858739288632No Hit
TATTGCACTTGTCCCGGCCTGTA112320.1969834109171812No Hit
TGTAAACATCCTTGACTGGAAGC111850.19615913916565814No Hit
TCGTACCGTGAGTAATAATGC110550.19387923857633887No Hit
AAGGTCCAACCTCACATGTCCT109290.1916694887743833No Hit
TGTAACAGCAACTCCATGTGGA106750.18721491377679036No Hit
TTCACAGTGGTTAAGTTCTGC101280.1776217936048087No Hit
TACCCTGTAGAACCGAATTTGT100980.17709566269958119No Hit
TGAGGTAGTTGGTTGTATAGTT100030.17542958149969404No Hit
TTTTGCAGAAACGTTTCAGATT95570.16760776870864502No Hit
TATTGCACTTGTCCCGGCCTGTAA93120.1633110329826203No Hit
TGAGGTAGTAAGTTGTGTTGTT91160.15987364440180057No Hit
TGAGAACTGAATTCCATAGATGG87210.1529462541496383No Hit
GGAATACCAGGTGCTGTAAGCTT86630.1519290677328651No Hit
TGAGGTAGTAGTTTGTATAGT85070.14919318702568204No Hit
TGAGGTAGTAGGTTGTGTGGTT84980.14903534775411378No Hit
CGCCTGTCTGAGGGTCGCT84590.148351377577318No Hit
TGAGGTAGTTGTTTGTACAGTT83750.14687821104268098No Hit
TATTGCACTTGTCCCGGCCTGTTT82820.14524720523647566No Hit
AAGTTCTGTGATACACTCAGACT79920.1401612731526097No Hit
TCCCTGAGACCCTAACTTGTGA77100.13521564264347108No Hit
TCACAGTGAACCGGTCTCTTT75950.1331988075067656No Hit
TTCACAGTGGCTAAGTTCTGCT75930.13316373211308377No Hit
AACTCCAGTCACGTGAAAATCTCG73530.12895468487126366TruSeq Adapter, Index 19 (95% over 24bp)
AACTCCAGTCACGTGAAAATCTCGTAT71450.1253068439283529TruSeq Adapter, Index 19 (96% over 27bp)
TACCCTGTAGAACCGAATTTGCG70990.12450010987367072No Hit
CCTCCTTGCTGAATGTCGAGAACTGAGC69500.12188699304437406No Hit
AACTCCAGTCACGTGAAAATCTC69110.1212030228675783TruSeq Adapter, Index 19 (95% over 23bp)
GAAGGATCATTA68500.12013322336028233No Hit
GCTACGCCTGTCTGAGGGTCGCT67250.1179410112551677No Hit
TGTTGTGATGAAACTAAACTGAAAATAGC66600.1168010609605081No Hit
TGTAAACATCCTACACTCTCAGC66440.1165204578110534No Hit
TACAGTACTGTGATAACTGAAG65690.11520513054798463No Hit
AAGAATGATGTATACTCTTTAATCTGAGA65020.11403010485964318No Hit
TCCCTGAGACCCTTAACCTGTGA64100.1124166367502788No Hit
AACATTCATTGCTGTCGGTGGG62160.10901432356314089No Hit
CCTCGATCCAAGTTTTTGT61070.10710271460748091No Hit
TTCACAGTGGTTAAGTTCTGCC61000.1069799507295945No Hit
TACGACCTCAGATCAGACGAGA60590.1062609051591169No Hit
TGAGGTAGTTAGTTGTGTTGTT58710.10296381815302447No Hit
AACCCGTAGATCCGAACTTGT57890.10152572701206926No Hit
TAGCTTATCAGACTGGTGTTGGCT57510.10085929453211441No Hit
TACAGTACTATGATAACTGAA57440.100736530654228No Hit
TGTAAACATCCCCGACTGGAA57250.10040331441425057No Hit
AACAGTAAGAGTTTATGTGCTG57140.10021039974900048No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA300.0601.837623
CAACCCG1250.0577.7640423
TAACTGC2000.0556.699723
CGTATGC27850.0508.914723
AATAACC1450.0498.0724523
TAACTAC201.3223125E-6451.3781423
GTATGCC4300.0405.890423
GATTCCT2750.0404.8725323
AAATAGC10100.0387.321223
CGCCCCA104.576821E-4362.1677222
TCTGACG253.2240223E-6361.102523
ATAACTA5000.0351.3026722
ACAACCC4600.0350.3579422
GACCACC650.0324.0663523
TAATAAC2000.0307.8425622
TCGTATG28900.0302.0153222
GGAAAGT306.676464E-6300.918823
TGCCCGA207.9689827E-4300.9187623
GGCGCCC504.6929927E-10300.9187623
TGCCGTC207.9689827E-4300.9187623