FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_12_JG14_3_GTGGCC_L004_R1_001_TRIMMED_prinseq_good_GPO7.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_12_JG14_3_GTGGCC_L004_R1_001_TRIMMED_prinseq_good_GPO7.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5680710
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC74013913.02898757373638No Hit
ATGACCTATGAATTGACAGCCA60555710.659882303444464No Hit
TTCAAGTAATCCAGGATAGGCT2772974.8813792642116915No Hit
CCTGTCTGAGGGTCGCT2520474.43689257152715No Hit
TGAGGTAGTAGGTTGTATAGTT1807143.181186858684918No Hit
AAGCTGCCAGCTGAAGAACTGT1085941.9116272437776263No Hit
TCAGTAACTGGAATCTGTCCCT1022131.7992997354203966No Hit
TAGCTTATCAGACTGGTGTTGGC932741.641942644493382No Hit
CTACGCCTGTCTGAGGGTCGCT889051.565033244083926No Hit
AACATTCAACGCTGTCGGTGAGT718581.2649475153633964No Hit
TATTGCACTTGTCCCGGCCTGT669241.178092175097831No Hit
AACATTCAACGCTGTCGGTGAG660341.1624251193952868No Hit
TGAGATGAAGCACTGTAGCTC602851.0612229809302007No Hit
TGAGATGAAGCACTGTAGCTCT569951.003307685130908No Hit
CTGTCTGAGGGTCGCT565200.9949460542784264No Hit
TGTAAACATCCTTGACTGGAAGCT488850.8605438404706454No Hit
TGAGGTAGTAGTTTGTATAGTT483590.851284434516108No Hit
TGTCTGAGGGTCGCT445110.7835464228943214No Hit
ATGACCTATGAATTGACAGCCAT411480.7243460764587526No Hit
ATGACCTATGAATTGACAGCCT387830.6827139565300816No Hit
ATGACCTATGAATTGACAGC356670.6278616581378031No Hit
TTCAAGTAATCCAGGATAGGTT323340.5691894147034438No Hit
TGGAGTGTGACAATGGTGTTTG314930.5543849272362081No Hit
TTCACAGTGGCTAAGTTCTG308400.5428898852432178No Hit
TTCCAGTGATGACAGCCTATAATCTGACT274980.4840592109084956No Hit
CCACGTTCCCGTGG269540.47448294315323264No Hit
TGTAAACATCCTACACTCTCAGCT261100.459625645385876No Hit
TTCACAGTGGCTAAGTTCTGC256510.45154566946737296No Hit
TGTAACAGCAACTCCATGTGGA246060.4331500815919137No Hit
TTCACAGTGGTTAAGTTCTG245990.4330268575582981No Hit
TACGCCTGTCTGAGGGTCGCT241520.4251581228402788No Hit
ACAGTAGTCTGCACATTGGTT234930.41355746024704665No Hit
TGAGGTAGTAGGTTGTATAGT233620.41125141047509906No Hit
TGAGGTAGTAGGTTGTATAGTTT232360.4090333778700198No Hit
TCCAGTGATGACAGCCTATAATCTGACT230650.40602319076312643No Hit
TGAGATGAAGCACTGTAGCT229860.40463251952660845No Hit
CCTGTCTGAGGGTCGCTT227630.4007069538842856No Hit
TCAGTAACTGGAATCTGTCCCTGC227320.40016124744970255No Hit
CTGGACAACTCTTAGCGG208780.3675244819749644No Hit
TGTAAACATCCCCGACTGGAAGCT183660.3233046573403677No Hit
AACCCGTAGATCCGAACTTGTG182780.32175555520348686No Hit
GGACAACTCTTAGCGG180000.31686180072561354No Hit
TGAGGTAGTAGATTGAATAGTT172460.30358881196188503No Hit
TCAGTAACTGGAATCTGTCCCTG166560.29320278627143437No Hit
TTCAAGTAATCCAGGATAGGCTT145960.2569397135217253No Hit
AACTCCAGTCACGTGGCCATCTCGTATGC144850.25498573241725064TruSeq Adapter, Index 20 (96% over 29bp)
AACTCCAGTCACGTGGCCATCT143710.2529789410126551TruSeq Adapter, Index 20 (95% over 22bp)
ACTGGACAACTCTTAGCGG142960.2516586835096317No Hit
AACATTCAACGCTGTCGGTGA140580.24746906636670418No Hit
TATTGCACTTGTCCCGGCCTGTT139730.24597277452994434No Hit
CATTGCACTTGTCTCGGTCTGA139020.2447229307604155No Hit
CATTATTACTTTTGGTACGCG137210.24153670931978571No Hit
TTCAAGTAATCCAGGATAGGC131790.23199564843127005No Hit
TGAGGTAGTAGTTTGTGCTGTT127560.22454939611421815No Hit
AAGCTGCCAGCTGAAGAACT121470.2138289051896682No Hit
TGGAGTGTGACAATGGTGTTTGT120800.21264947515363397No Hit
TCGTACCGTGAGTAATAATGCA115610.2035132932327121No Hit
TAGCTTATCAGACTGGTGTTGG113710.2001686408917195No Hit
TATTGCACTTGTCCCGGCCTGTAT108490.1909796486706767No Hit
AACTCCAGTCACGTGGCCATCTC106410.18731813452895854TruSeq Adapter, Index 20 (95% over 23bp)
TAACGGAACCCATAATGCAGCTG104420.18381505128760314No Hit
TCAGTAACAAGGATTCATCCTG103310.18186107018312853No Hit
AACTGGACAACTCTTAGCGG101810.17922055517708174No Hit
TATTGCACTTGTCCCGGCCTGTA100170.17633359210380392No Hit
TGTAAACATCCCCGACTGGA97320.17131661359231504No Hit
TGTAAACATCCTACACTCAGCT97060.17085892432460026No Hit
TCGTACCGTGAGTAATAATGC95880.16878171918651014No Hit
TACCCTGTAGATCCGGATTTGT94590.16651087628130992No Hit
AACTCCAGTCACGTGGCCATCTCG93010.16372953380827399TruSeq Adapter, Index 20 (95% over 24bp)
AACTCCAGTCACGTGGCCATCTCGTAT91040.16026165743366586TruSeq Adapter, Index 20 (96% over 27bp)
ATGACCTATGAATTGACAGCCAG90920.1600504162331821No Hit
TGTAAACATCCCCGACTGGAAGC89710.15792040079497105No Hit
TACCCTGTAGAACCGAATTTGT89590.1577091595944873No Hit
CGCCTGTCTGAGGGTCGCT85870.1511606823794913No Hit
TGGAGTGTGACAATGGTGTTT84960.1495587699424896No Hit
ACAGTAGTCTGCACATTGGTTA84880.14941794247550041No Hit
TTCACAGTGGTTAAGTTCTGC84030.14792165063874058No Hit
TATTGCACTTGTCCCGGCCTGTTT82210.14471782576473716No Hit
TGAGGTAGTAGGTTGTGTGGTT80800.14223574165905317No Hit
GAAGGATCATTA80040.14089788072265613No Hit
TACCCTGTAGAACCGAATTTGCG79620.14015853652096305No Hit
TATTGCACTTGTCCCGGCCTGTAA77320.13610974684502467No Hit
TGTAAACATCCTTGACTGGAAGC76660.13494792024236407No Hit
CTACGCCTGTCTGAGGGTCGCTT76470.13461345500826483No Hit
TGAGAACTGAATTCCATAGATGG75990.13376849020632983No Hit
TTCACAGTGGCTAAGTTCTGCT71350.12560049712095847No Hit
AAACCGTTACCATTACTGAGTTT71110.125178014719991No Hit
TGAGGTAGTTGTTTGTACAGTT70320.123787343483473No Hit
AAGTTCTGTGATACACTCAGACT68570.12070674264308512No Hit
ATGACCTATGAATTGACAG67050.11803102077029104No Hit
TCACAGTGAACCGGTCTCTTT65970.11612984996593737No Hit
AGCTACATCTGGCTACTGGGTCTC65420.11516166113038687No Hit
AAGCTGCCAGCTGAAGAACTGC61900.10896525258286376No Hit
GCTACGCCTGTCTGAGGGTCGCT61350.10799706374731328No Hit
TTTTGCAGAAACGTTTCAGATT61060.10748656417947756No Hit
TCCCTGAGACCCTAACTTGTGA60400.10632473757681699No Hit
AAGGTCCAACCTCACATGTCCT59770.10521572127427735No Hit
TAGCTTATCAGACTGGTGTTGGCT59510.10475803200656257No Hit
AACAGTAAGAGTTTATGTGCTG58180.10241677536786775No Hit
CCTCGATCCAAGTTTTTGT58160.10238156850112046No Hit
CAAGCTCGTATCTATAGGTATG57290.10085006979761334No Hit
TGAGGTAGTAAGTTGTGTTGTT57280.10083246636423968No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GACCACC103.5905185E-5846.449323
AATAACC600.0846.449223
TAACTAA650.0846.4491623
CAACCCG1600.0819.9977423
TAACTGC2300.0791.24623
CGTATGC20400.0732.3445423
TGGTCTC259.731593E-10677.1593623
CCGTCTT151.2107286E-4564.2994423
CGTAGGC151.2107286E-4564.2994423
AAATAGC2000.0529.0307623
GATTCCT2400.0511.396423
ATATGAC450.0476.4444622
ATAACAC102.011875E-4476.4444622
ATAACTA5550.0463.567622
ACAACCC5200.0453.5384822
AGACTTT202.8673373E-4423.2246423
TCGTATG21300.0411.5764522
GCATAGC500.0381.1555822
TCTGACT60350.0373.0828223
TAATAAC850.0364.3398722