FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_12_JG15_3_CCGTCC_L008_R1_001_TRIMMED_prinseq_good_FXrH.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_12_JG15_3_CCGTCC_L008_R1_001_TRIMMED_prinseq_good_FXrH.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10993249
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC8640567.859878367168796No Hit
TTCAAGTAATCCAGGATAGGCT8015837.291593231445955No Hit
ATGACCTATGAATTGACAGCCA7382226.715230410954942No Hit
TGAGGTAGTAGGTTGTATAGTT4299033.9106091383902974No Hit
TCAGTAACTGGAATCTGTCCCT3989613.629145487380482No Hit
CCTGTCTGAGGGTCGCT3650463.320637966082639No Hit
AAGCTGCCAGCTGAAGAACTGT2258912.054815641854378No Hit
AACATTCAACGCTGTCGGTGAG1963661.7862417198045817No Hit
AACATTCAACGCTGTCGGTGAGT1925851.751847884096867No Hit
TAGCTTATCAGACTGGTGTTGGC1508351.3720693491068927No Hit
TATTGCACTTGTCCCGGCCTGT1456201.3246311440776062No Hit
TGAGGTAGTAGTTTGTATAGTT1314431.1956701790344237No Hit
CTACGCCTGTCTGAGGGTCGCT1308961.190694397989166No Hit
TGAGATGAAGCACTGTAGCTCT1018440.9264231165872802No Hit
TGAGATGAAGCACTGTAGCTC908960.8268347237472743No Hit
TTCAAGTAATCCAGGATAGGTT892660.8120074420219173No Hit
TTCACAGTGGCTAAGTTCTG877650.7983536077459903No Hit
CTGTCTGAGGGTCGCT760110.6914334424700105No Hit
TTCCAGTGATGACAGCCTATAATCTGACT731870.6657449494685329No Hit
TGTAAACATCCTTGACTGGAAGCT725150.6596321069412692No Hit
TTCACAGTGGCTAAGTTCTGC695940.633061254229755No Hit
TGGAGTGTGACAATGGTGTTTG678920.6175790250907625No Hit
TGAGGTAGTAGGTTGTATAGT676200.6151047793059177No Hit
TCAGTAACTGGAATCTGTCCCTGC658430.5989403132777216No Hit
AACATTCAACGCTGTCGGTGA642390.5843495403406218No Hit
TGAGGTAGTAGGTTGTATAGTTT637480.5798831628393026No Hit
ATGACCTATGAATTGACAGCCAT606520.5517204240529802No Hit
TCAGTAACTGGAATCTGTCCCTG596410.5425238707865164No Hit
ACAGTAGTCTGCACATTGGTT589990.536683923014934No Hit
TGTCTGAGGGTCGCT585820.5328906859109622No Hit
TTCACAGTGGTTAAGTTCTG584520.5317081419696761No Hit
TCCAGTGATGACAGCCTATAATCTGACT539040.4903372970083731No Hit
TGAGATGAAGCACTGTAGCT528760.48098610338035647No Hit
TGTAAACATCCTACACTCTCAGCT512700.46637713745954446No Hit
TTCAAGTAATCCAGGATAGGCTT476770.4336934422207666No Hit
TTTGTTCGTTCGGCTCGCGTTA464940.42293229235506263No Hit
CATTATTACTTTTGGTACGCG399230.3631592443689759No Hit
TTTGTTCGTTCGGCTCGCGTT393870.35828352473413455No Hit
ATGACCTATGAATTGACAGC392430.35697362990686377No Hit
TATTGCACTTGTCCCGGCCTGTT380410.34603964669589493No Hit
ATGACCTATGAATTGACAGCCT378370.3441839623572613No Hit
TTCAAGTAATCCAGGATAGGC374970.3410911551262052No Hit
TACGCCTGTCTGAGGGTCGCT366610.33348648793454966No Hit
CATTGCACTTGTCTCGGTCTGA365850.33279515455349007No Hit
TCGTACCGTGAGTAATAATGCA362650.32988427715955493No Hit
GCATTGTTGGTTCAGTGGTAGAATGC336200.30582405620030984No Hit
TGGAGTGTGACAATGGTGTTTGT314400.28599370395412677No Hit
TACCCTGTAGATCCGGATTTGT311960.2837741599412512No Hit
TGTAAACATCCCCGACTGGAAGCT310210.28218227386644296No Hit
TATTGCACTTGTCCCGGCCTGTA302850.27548725586039213No Hit
TGAGGTAGTAGATTGAATAGTT300120.2730039135836912No Hit
AACTCCAGTCACCCGTCCATCT290610.26435314982859026TruSeq Adapter, Index 16 (95% over 22bp)
CCACGTTCCCGTGG285840.2600141232132557No Hit
TGTAAACATCCTACACTCAGCT282650.25711234231117663No Hit
TATTGCACTTGTCCCGGCCTGTAT277530.2524549384808804No Hit
TGTAACAGCAACTCCATGTGGA275580.25068112256895114No Hit
AAGCTGCCAGCTGAAGAACT272560.2479339820284249No Hit
TGTAAACATCCCCGACTGGA271710.24716078022066088No Hit
TAGCTTATCAGACTGGTGTTGG263520.23971075339055814No Hit
TGAGGTAGTAGTTTGTGCTGTT260010.23651788474908556No Hit
AACCCGTAGATCCGAACTTGTG252610.22978648077561056No Hit
TCGTACCGTGAGTAATAATGC247420.22506540150232202No Hit
TGGAGTGTGACAATGGTGTTT240890.21912539232032316No Hit
TGTAAACATCCCCGACTGGAAGC235900.21458624288415554No Hit
TATTGCACTTGTCCCGGCCTGTTT231810.21086577771503218No Hit
GGACAACTCTTAGCGG225220.204871189581897No Hit
ACAGTAGTCTGCACATTGGTTA201900.18365817057359476No Hit
TGAGGTAGTTGGTTGTATAGTT198350.18042891596469796No Hit
TTCACAGTGGCTAAGTTCTGCT195940.17823666142739056No Hit
TACCCTGTAGAACCGAATTTGT191200.17392492428762418No Hit
TTCACAGTGGTTAAGTTCTGC190740.17350648566224597No Hit
CTGGACAACTCTTAGCGG189510.17238761716395218No Hit
TAACGGAACCCATAATGCAGCTG188880.1718145381770212No Hit
TATTGCACTTGTCCCGGCCTGTAA188370.17135061709236277No Hit
TGTAAACATCCTTGACTGGAAGC185390.1686398625192607No Hit
CCTGTCTGAGGGTCGCTT174520.15875197587173728No Hit
TTTTGCAGAAACGTTTCAGATT172250.15668707222041453No Hit
TCACAGTGAACCGGTCTCTTT158190.14389740467081205No Hit
AACTCCAGTCACCCGTCCATCTCGTATGC148960.1355013426876804TruSeq Adapter, Index 16 (96% over 29bp)
TGAGGTAGTAGTTTGTATAGT145390.13225389509507154No Hit
AACTCCAGTCACCCGTCCATCTC145010.13190822840454172TruSeq Adapter, Index 16 (95% over 23bp)
TGAGAACTGAATTCCATAGATGG143350.13039821075643787No Hit
AAGTTCTGTGATACACTCAGACT142710.12981603527765084No Hit
AACAGTAAGAGTTTATGTGCTG142590.12970687737537828No Hit
ACTGGACAACTCTTAGCGG141120.12836969307253934No Hit
TGAGGTAGTTGTTTGTACAGTT140490.12779661408560836No Hit
TACAGTACTGTGATAACTGAAG139790.12715985965568505No Hit
TCCCTGAGACCCTAACTTGTGA139080.1265140087339057No Hit
TGAGGTAGTAGGTTGTGTGGTT136350.12403066645720479No Hit
GAAGGATCATTA135280.12305734182860772No Hit
CGCCTGTCTGAGGGTCGCT133750.12166557857463249No Hit
TGAGGTAGTAAGTTGTGTTGTT131750.11984628020342303No Hit
TGTAAACATCCTACACTCTCAGC129980.11823620114490266No Hit
AAGTTCTGTGATACACTTTGACT126920.11545267463695219No Hit
TCAGTGCATTACAGAACTTTGT125800.1144338675490749No Hit
GCATGAGTGACTGGTTAATCTTT124850.11356970082275039No Hit
TCCCTGAGACCCTTAACCTGTGA122210.11116822697275393No Hit
AACATTCAACGCTGTCGGTGAGA120360.10948537597938518No Hit
AACTCCAGTCACCCGTCCATCTCG119280.10850295485893206TruSeq Adapter, Index 16 (95% over 24bp)
TGAGGTAGTTGGTTGTATTGTT118550.1078389109534406No Hit
AAGAATGATGTATACTCTTTAATCTGAGA118420.10772065655931198No Hit
TGTGCAAATCCATGCAAAACTG117020.10644714769946537No Hit
CCTCCTTGCTGAATGTCGAGAACTGAGC115980.10550111254643646No Hit
TACAGTACTATGATAACTGAAT114660.10430037562143822No Hit
TCCCTGAGACCCTTAACCTGTG114290.10396380542276445No Hit
TACCCTGTAGAACCGAATTTGCG111950.1018352263284494No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC19250.0685.644723
ACATAGC350.0673.4010623
TAACTGC2000.0648.1484423
AATAACC2700.0625.5978423
CAACCCG1700.0600.779323
AAATAGC3700.0562.684223
ATTTTCG450.0523.7563523
GATATCT1800.0480.1123
GATTCCT5850.0470.0377823
GGCTTCG102.8768825E-4422.9076522
GCCCTCT102.8768825E-4422.9076522
ATAACTA6450.0416.3509522
ATACTCG203.5878332E-4392.8172623
AGCATGG2050.0383.2363623
TCTGACT153150.0379.3514423
ACAACCC7600.0378.3910822
TCGTATG20000.0362.643322
GTACTCT3550.0343.0235323
ATCACTA650.0325.313622
GCTGAGC12250.0323.8738423