FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_14_JG67_3_CGTACG_L007_R1_001_TRIMMED_prinseq_good_uypO.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_14_JG67_3_CGTACG_L007_R1_001_TRIMMED_prinseq_good_uypO.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7611045
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC5526827.261578403491242No Hit
ATGACCTATGAATTGACAGCCA4650376.1100282549899525No Hit
CCTGTCTGAGGGTCGCT3516704.6205218862849975No Hit
TTCAAGTAATCCAGGATAGGCT3356184.409617864563933No Hit
TGAGGTAGTAGGTTGTATAGTT2782453.6558054774344395No Hit
TCAGTAACTGGAATCTGTCCCT2622883.446149641737764No Hit
AACATTCAACGCTGTCGGTGAGT1177061.5465156230189154No Hit
AACATTCAACGCTGTCGGTGAG1127341.481189508142443No Hit
AAGCTGCCAGCTGAAGAACTGT1124661.477668309673639No Hit
TAGCTTATCAGACTGGTGTTGGC1105271.4521921759758352No Hit
CTACGCCTGTCTGAGGGTCGCT1082271.4219729353853512No Hit
TCAGTAACTGGAATCTGTCCCTGC861621.132065307720556No Hit
TATTGCACTTGTCCCGGCCTGT822841.0811130403249487No Hit
CTGTCTGAGGGTCGCT789781.0376761666761924No Hit
TGAGGTAGTAGTTTGTATAGTT697660.9166415387111757No Hit
TGTCTGAGGGTCGCT641990.8434978376819477No Hit
TGTAAACATCCTTGACTGGAAGCT564110.7411728612825177No Hit
TGAGATGAAGCACTGTAGCTC542110.712267500717707No Hit
CCACGTTCCCGTGG501300.6586480568699831No Hit
TCAGTAACTGGAATCTGTCCCTG490480.6444318749921988No Hit
TTCACAGTGGCTAAGTTCTG483210.6348799672055545No Hit
TGAGATGAAGCACTGTAGCTCT469090.6163279812430488No Hit
TTCACAGTGGCTAAGTTCTGC436710.5737845460117501No Hit
TGGAGTGTGACAATGGTGTTTG421820.5542208724294758No Hit
TGTAAACATCCTACACTCTCAGCT406020.533461568023839No Hit
GGACAACTCTTAGCGG377450.49592401569035527No Hit
TTCAAGTAATCCAGGATAGGTT370500.48679254951192646No Hit
TTCACAGTGGTTAAGTTCTG337110.44292209545469774No Hit
TACGCCTGTCTGAGGGTCGCT306110.4021918146588281No Hit
CTGGACAACTCTTAGCGG300290.39454503290940995No Hit
TGAGGTAGTAGGTTGTATAGT291700.38325880348887703No Hit
AACTCCAGTCACCGTACGATCT288220.3786865009995342TruSeq Adapter, Index 22 (95% over 22bp)
AACATTCAACGCTGTCGGTGA268380.35261912129017764No Hit
TGAGGTAGTAGGTTGTATAGTTT264220.34715338038337706No Hit
TGAGGTAGTAGATTGAATAGTT261850.34403948472253154No Hit
TGAGGTAGTAGTTTGTGCTGTT261510.34359276551380263No Hit
TGAGATGAAGCACTGTAGCT246130.32338529071894856No Hit
CATTATTACTTTTGGTACGCG241080.31675019658929887No Hit
ACAGTAGTCTGCACATTGGTT241030.31668450258801517No Hit
TGTAAACATCCCCGACTGGAAGCT239920.3152260957595179No Hit
ATGACCTATGAATTGACAGCCAT238160.31291366691433303No Hit
CCTGTCTGAGGGTCGCTT234480.30807858841985564No Hit
TTCCAGTGATGACAGCCTATAATCTGACT208300.2736812093477308No Hit
ATGACCTATGAATTGACAGC204820.26910890685838806No Hit
CATTGCACTTGTCTCGGTCTGA196450.2581117310435032No Hit
ACTGGACAACTCTTAGCGG193430.2541438133659701No Hit
TCGTACCGTGAGTAATAATGCA191770.25196277252335253No Hit
AACCCGTAGATCCGAACTTGTG185560.2438035775639219No Hit
AACTCCAGTCACCGTACGATCTCGTATGC174010.2286282632673963TruSeq Adapter, Index 22 (96% over 29bp)
TAGCTTATCAGACTGGTGTTGG172030.22602678081656327No Hit
AACTCCAGTCACCGTACGATCTC171210.22494939919551127TruSeq Adapter, Index 22 (95% over 23bp)
CCTCGATCCAAGTTTTTGT168680.221625282730558No Hit
GAAGGATCATTA163070.2142544157865313No Hit
ATGACCTATGAATTGACAGCCT160200.21048358011284915No Hit
AACTGGACAACTCTTAGCGG159260.20924853288871634No Hit
TCCAGTGATGACAGCCTATAATCTGACT158810.20865728687716337No Hit
TTTGTTCGTTCGGCTCGCGTTA157920.20748793365431423No Hit
TTCAAGTAATCCAGGATAGGC151780.1994207102966807No Hit
TGTAAACATCCTACACTCAGCT151280.19876377028384407No Hit
TGTAACAGCAACTCCATGTGGA148230.19475643620554078No Hit
TATTGCACTTGTCCCGGCCTGTT146050.19189217774957315No Hit
AACTCCAGTCACCGTACGATCTCG145050.19057829772389992TruSeq Adapter, Index 22 (95% over 24bp)
TACCCTGTAGATCCGGATTTGT136860.1798176203136363No Hit
TTTGTTCGTTCGGCTCGCGTT136540.17939717870542088No Hit
TGGAGTGTGACAATGGTGTTTGT132610.17423363020452515No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT129770.1705022109316132No Hit
TTCACAGTGGTTAAGTTCTGC129310.16989782611980353No Hit
AAGTTCTGTGATACACTCAGACT128660.16904380410311595No Hit
CGCCTGTCTGAGGGTCGCT126240.16586421444098673No Hit
TTCAAGTAATCCAGGATAGGCTT123730.162566375576547No Hit
TGTAAACATCCCCGACTGGAAGC116440.15298819018938922No Hit
CTCGATCCAAGTTTTTGT116010.15242322177834974No Hit
CAGTCGGTAGAGCATC112980.14844216530055993No Hit
TGAGGTAGTAGGTTGTGTGGTT109830.14430344321968927No Hit
TGTAAACATCCCCGACTGGA106290.1396523079288061No Hit
AAGCTGCCAGCTGAAGAACT105590.13873259191083484No Hit
TCGTACCGTGAGTAATAATGC101270.13305663019992656No Hit
TGAGGTAGTTGGTTGTATTGTT100390.1319004157773341No Hit
ACAGTAGTCTGCACATTGGTTA100210.13166391737271296No Hit
TTCACAGTGGCTAAGTTCTGCT96880.12728869688722114No Hit
GAATACCAGGTGCTGTAAGCTT95930.12604051086283158No Hit
TGGAGTGTGACAATGGTGTTT94800.12455582643382086No Hit
TACCCTGTAGAACCGAATTTGCG92040.12092951756296277No Hit
TGAGGTAGTTGTTTGTACAGTT92000.12087696236193583No Hit
TATTGCACTTGTCCCGGCCTGTA91810.12062732515705793No Hit
TACCCTGTAGAACCGAATTTGT91420.12011491194704538No Hit
CACGTTCCCGTGG90030.11828861871135961No Hit
TATTGCACTTGTCCCGGCCTGTAT89650.11778934430160379No Hit
TGAGGTAGTAAGTTGTGTTGTT85810.11274404500301864No Hit
TAACGGAACCCATAATGCAGCTG84970.11164038578145313No Hit
TTCACAGTGGTTAAGTTCTGCC84050.11043161615783378No Hit
TGAGGTAGTTGGTTGTATAGTT84030.11040533855732032No Hit
AACATTCATTGCTGTCGGTGGG82870.10888123772753938No Hit
ACCACGTTCCCGTGG81780.10744910849955558No Hit
TATTGCACTTGTCCCGGCCTGTTT80920.1063191716774766No Hit
TGTAAACATCCTTGACTGGAAGC79990.10509726325360053No Hit
CACCACGTTCCCGTGG79700.10471623804615528No Hit
TCACAGTGAACCGGTCTCTTT79400.10432207403845332No Hit
AACATTCATTGCTGTCGGTGGGT78600.10327097001791474No Hit
TACGACCTCAGATCAGACGAGA78190.10273227920738874No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAC108.572925E-5633.309823
TAACTGC2150.0603.853623
CAACCCG5600.0588.073423
CGTATGC20350.0552.3955723
GATTCCT8650.0453.9330723
AATAACC700.0407.1277523
CCCGCCT3300.0364.6329323
ATAACTA3250.0347.4539222
AAATAGC9000.0327.210123
ACAACCC12500.0326.6066622
CATAGCT1200.0316.6549423
CCGTGAC206.842132E-4316.654923
ATATGAC305.9299055E-10289.5449222
GCATAGC1800.0279.893422
TCTGACT50350.0266.0278623
TCGTATG24350.0261.83922
ACACAGC250.0013347742253.3239323
TAATAAC1100.0252.6937422
TCTCGAG100.0014547908246.1833521
GGATTCC16450.0246.0691722