FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_14_JG68_3_GAGTGG_L006_R1_001_TRIMMED_prinseq_good_mzEN.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_14_JG68_3_GAGTGG_L006_R1_001_TRIMMED_prinseq_good_mzEN.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3982705
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC40114410.072149456211294No Hit
ATGACCTATGAATTGACAGCCA2817597.074563644558158No Hit
TTCAAGTAATCCAGGATAGGCT2044575.133621495943084No Hit
TGAGGTAGTAGGTTGTATAGTT1654334.1537849275806265No Hit
CCTGTCTGAGGGTCGCT1219003.0607338479751824No Hit
TAGCTTATCAGACTGGTGTTGGC827472.077658274966386No Hit
TCAGTAACTGGAATCTGTCCCT792921.9909081892834142No Hit
AACATTCAACGCTGTCGGTGAG776311.949202865891398No Hit
AAGCTGCCAGCTGAAGAACTGT745521.871893599952796No Hit
AACATTCAACGCTGTCGGTGAGT653291.6403173220210887No Hit
TGAGGTAGTAGTTTGTATAGTT606351.5224577265953667No Hit
TGTAAACATCCTTGACTGGAAGCT571291.4344271041917491No Hit
CTACGCCTGTCTGAGGGTCGCT395930.9941233407947614No Hit
TATTGCACTTGTCCCGGCCTGT351810.8833443601773165No Hit
TTCACAGTGGCTAAGTTCTG314230.7889863798599193No Hit
GGACAACTCTTAGCGG296930.7455485656105587No Hit
TGTAAACATCCTACACTCTCAGCT286170.7185317516612454No Hit
TTCACAGTGGCTAAGTTCTGC271580.6818983580255128No Hit
CTGTCTGAGGGTCGCT261120.655634800970697No Hit
TGGAGTGTGACAATGGTGTTTG260620.654379372813201No Hit
TTCACAGTGGTTAAGTTCTG257380.6462441983526271No Hit
TTCAAGTAATCCAGGATAGGTT237850.5972071745208345No Hit
TGAGATGAAGCACTGTAGCTC233270.5857074525981714No Hit
CTGGACAACTCTTAGCGG226450.5685834125299263No Hit
TGTCTGAGGGTCGCT222010.557435210491362No Hit
TCAGTAACTGGAATCTGTCCCTGC212760.5342097895776865No Hit
AACTCCAGTCACGAGTGGATCTCGTATGC199170.500087252256946RNA PCR Primer, Index 23 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCT198690.49888204122574986No Hit
CATTATTACTTTTGGTACGCG193880.4868048223506386No Hit
TGTAAACATCCCCGACTGGAAGCT189720.4763596600802721No Hit
TGAGGTAGTAGGTTGTATAGTTT182730.4588087744384784No Hit
TTCCAGTGATGACAGCCTATAATCTGACT171410.43038588095276953No Hit
AACTCCAGTCACGAGTGGATCT167160.4197147416140538RNA PCR Primer, Index 23 (100% over 22bp)
CCACGTTCCCGTGG157640.3958113894953304No Hit
TGAGGTAGTAGTTTGTGCTGTT157440.39530921823233206No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT153210.3846882960199161No Hit
TGAGGTAGTAGGTTGTATAGT150840.3787375665533852No Hit
TGAGATGAAGCACTGTAGCT148630.37318857409725303No Hit
ACTGGACAACTCTTAGCGG146040.36668545624142385No Hit
TCAGTAACTGGAATCTGTCCCTG145910.3663590449204749No Hit
AACCCGTAGATCCGAACTTGTG141770.35596409977640825No Hit
AAACCGTTACCATTACTGAGTTT140470.3526999865669187No Hit
ACAGTAGTCTGCACATTGGTT132490.332663353173283No Hit
TCGTACCGTGAGTAATAATGCA131430.33000184547939154No Hit
ATGACCTATGAATTGACAGCCAT131400.32992651978994175No Hit
AACTGGACAACTCTTAGCGG128710.32317231630261345No Hit
TACGCCTGTCTGAGGGTCGCT125390.31483627333684017No Hit
TGAGGTAGTAGATTGAATAGTT124630.3129280225374463No Hit
ATGACCTATGAATTGACAGC115100.288999561855573No Hit
TCCAGTGATGACAGCCTATAATCTGACT114560.28764369944547735No Hit
TACCCTGTAGAACCGAATTTGCG114410.2872670709982286No Hit
ATGACCTATGAATTGACAGCCT111160.2791067879745048No Hit
CCTGTCTGAGGGTCGCTT110270.27687212585416193No Hit
AACTCCAGTCACGAGTGGATCTC103140.2589697203282693RNA PCR Primer, Index 23 (100% over 23bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCG102550.2574883151024241No Hit
CATTGCACTTGTCTCGGTCTGA99850.2507090030519459No Hit
TCGTACCGTGAGTAATAATGC96140.24139372612332574No Hit
AAGTTCTGTGATACACTCAGACT95150.2389079783714837No Hit
TGTAAACATCCTACACTCAGCT94180.23647244774594153No Hit
TACCCTGTAGAACCGAATTTGT93890.23574429941459388No Hit
CAGTCGGTAGAGCATC90950.22836238184851754No Hit
TAGCTTATCAGACTGGTGTTGG90020.22602728547557505No Hit
TTCAAGTAATCCAGGATAGGC89390.2244454459971301No Hit
AACATTCAACGCTGTCGGTGA89200.22396838329728164No Hit
TGGAGTGTGACAATGGTGTTTGT88860.22311469215018434No Hit
TACCCTGTAGATCCGGATTTGT88220.2215077441085895No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC85640.21502973481591028No Hit
TTCACAGTGGTTAAGTTCTGC84710.2126946384429678No Hit
AAGGTCCAACCTCACATGTCCT83970.21083660476987373No Hit
AACTCCAGTCACGAGTGGATCTCG75930.19064931999733847RNA PCR Primer, Index 23 (100% over 24bp)
TTCAAGTAATCCAGGATAGGCTT72270.18145958588446795No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC69440.17435386251304075No Hit
TGTAAACATCCCCGACTGGAAGC66440.1668212935680649No Hit
TGTAACAGCAACTCCATGTGGA65500.1644610886319725No Hit
TATTGCACTTGTCCCGGCCTGTT65370.16413467731102355No Hit
AACTCCAGTCACGAGTGGATCTCGTAT65260.1638584831163744RNA PCR Primer, Index 23 (100% over 27bp)
TTTTGCAGAAACGTTTCAGATT64190.16117186685933305No Hit
TGAGGTAGTAGGTTGTGTGGTT63300.1589372047389902No Hit
AAGCTGCCAGCTGAAGAACT62440.15677786830809712No Hit
TGTAAACATCCCCGACTGGA61450.15429212055625513No Hit
ACAGTAGTCTGCACATTGGTTA61100.15341332084600792No Hit
TAACGGAACCCATAATGCAGCTG57150.14349543840178974No Hit
TTCACAGTGGTTAAGTTCTGCC57140.1434703298386398No Hit
TACCCTGTAGAACCGAATTTGC57120.14342011271233998No Hit
AGCTACATCTGGCTACTGGGTCTC56880.1428175071967419No Hit
TGTAAACATCCTTGACTGGAAGC56590.14208935886539426No Hit
TATTGCACTTGTCCCGGCCTGTAT56340.14146164478664627No Hit
TCGGTAGAGCATGAGACT55710.13987980530820132No Hit
TGAGGTAGTAAGTTGTGTTGTT54120.13588754376736414No Hit
TTCACAGTGGCTAAGTTCTGCT54060.13573689238846462No Hit
TGGACAACTCTTAGCGG53990.13556113244641518No Hit
AAGTTCTGTGATACACTTTGACT53850.1352096125623163No Hit
AACATTCATTGCTGTCGGTGGG49310.12381032489225288No Hit
CAAGCTCGTATCTATAGGTATG49100.12328304506610457No Hit
AACAGTAAGAGTTTATGTGCTG48180.12097305725631198No Hit
TACCCTGTAGATCCGGATTTGTG47930.120345343177564No Hit
TATTGCACTTGTCCCGGCCTGTA47200.11851241806761986No Hit
TACAGTACTGTGATAACTGAAG45540.11434439658473323No Hit
CGCCTGTCTGAGGGTCGCT45130.11331494549558654No Hit
TGAGGTAGTTAGTTGTGTTGTT44790.11246125434848928No Hit
GGATATCATCTTATACTGTAAGT44690.11221016871699008No Hit
TGGAGTGTGACAATGGTGTTT44660.11213484302754033No Hit
TGAGGTAGTTGTTTGTACAGTT44440.1115824546382421No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG44400.11148202038564242No Hit
TCCCTGAGACCCTAACTTGTGA43380.10892094694435063No Hit
TGAGGTAGTTGGTTGTATTGTT41270.10362304011971764No Hit
CTACAGTATAGATGATGTACT41190.10342217161451828No Hit
TGTAAACATCCTACACTCTCAGC40870.10261869759372086No Hit
TGAGGTAGTAGTTTGTATAGT40400.10143859512567463No Hit
TCCCTGTTCGGGCGCCA40340.10128794374677512No Hit
TATTGCACTTGTCCCGGCCTGTAA40170.1008610981732265No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATCGCC159.183859E-7494.4615223
AATAACC700.0459.1428523
CCCTCTG400.0432.6538723
CGTATGC25600.0417.2019323
GATTCCT19900.0397.55723
CCCGTTC500.0395.5692423
CACGTCT850.0378.1176523
CCCGCCT1450.0375.1087323
TCGGATA202.897872E-6370.8461623
CAACCCG550.0359.608423
TAACTGC1250.0356.012323
GCTTCCT1100.0337.1328723
AGTATTT303.5417543E-8329.6410223
GGCAATG503.6379788E-12296.676923
GGGCCCT257.063465E-6296.676923
GCCCTCT350.0296.5593622
ACACCTT108.3275884E-4296.5593322
ATCACTA157.081362E-6296.5593322
TTATCGC157.081362E-6296.5593322
GCATTTC108.3275884E-4296.5593322