FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_14_JG70_3_GGTAGC_L005_R1_001_TRIMMED_prinseq_good_XC1X.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_14_JG70_3_GGTAGC_L005_R1_001_TRIMMED_prinseq_good_XC1X.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11108685
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC4578484.121531936498334No Hit
ATGACCTATGAATTGACAGCCA3367323.031249873409859No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG3066482.760434740925681No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC2909182.6188338223651133No Hit
TGAGGTAGTAGGTTGTATAGTT2505842.255748542694297No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT2356942.1217092752202444No Hit
TTCAAGTAATCCAGGATAGGCT2261522.035812519663669No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC1554341.3992115178349191No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG1392281.2533256636586598No Hit
CCTGTCTGAGGGTCGCT1268421.1418273179948841No Hit
GCATTGGTGGTTCAGTGGTAGAATTCT1187531.069010418424863No Hit
AAGCTGCCAGCTGAAGAACTGT880030.7921999768649485No Hit
TAGCTTATCAGACTGGTGTTGGC848560.7638707911872558No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGC842080.7580375174919444No Hit
AACATTCAACGCTGTCGGTGAG802640.7225337652476418No Hit
TGAGGTAGTAGTTTGTATAGTT730520.6576115894905653No Hit
GTGTAATGGTTAGCACTCTG661520.5954980269941942No Hit
AACATTCAACGCTGTCGGTGAGT661090.5951109424742892No Hit
CTACGCCTGTCTGAGGGTCGCT603340.5431245912545004No Hit
TATTGCACTTGTCCCGGCCTGT601370.5413512040354012No Hit
TGTAAACATCCTTGACTGGAAGCT595620.5361750738273702No Hit
GAGAGAGGCATGATCGTAGCGATA564110.5078098802873607No Hit
GCATGTGGTTCAGTGGTAGAATTCTCGCC549340.4945139771269057No Hit
GCATTGTGGTTCAGTGGTAGAATTCTC525910.473422371774877No Hit
CCACGTTCCCGTGG504920.4545272460241694No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGC500550.45059338706606594No Hit
TGGGAATACCAGGTGCTGTAAGCTT493530.4442740072294785No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTC491710.44263564949406703No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCG485000.4365953305904344No Hit
GCATTGGTGGTTCAGTGGTAGAATTC475420.4279714475655759No Hit
TCAGTAACTGGAATCTGTCCCT461390.41534168985798053No Hit
AACTCCAGTCACGGTAGCATCT459530.4136673242602522RNA PCR Primer, Index 24 (100% over 22bp)
CTGGACAACTCTTAGCGG423530.38126024817518905No Hit
GCATTGTGGTTCAGTGGTAGAATTCT398310.35855729098448647No Hit
GCGTTGGTGGTATAGTGGTTAGCATAGC383480.3452073760305563No Hit
TGTAAACATCCTACACTCTCAGCT356970.3213431652801389No Hit
GGAATACCAGGTGCTGTAAGCTT354650.3192547092657682No Hit
GGCCGTGATCGTATAGTGGTTAGTACTCT353260.31800343605026155No Hit
TTCACAGTGGCTAAGTTCTG351630.31653611566085454No Hit
TTCAAGTAATCCAGGATAGGTT335350.3018809156979426No Hit
GCGTTGGTGGTATAGTGGTTAGCATAGCT320430.2884499830537998No Hit
GGACAACTCTTAGCGG319950.2880178887059989No Hit
TTCACAGTGGCTAAGTTCTGC319760.28784685135999444No Hit
GGTCCCATGGTGTAATGGTTAGCACTCTG313270.2820045756991039No Hit
CTGTCTGAGGGTCGCT306240.27567619389693737No Hit
TGAGGTAGTAGGTTGTATAGTTT290770.2617501531459394No Hit
GGCTTGGTCTAGGGGTATGATTCT284630.2562229462803203No Hit
TTCACAGTGGTTAAGTTCTG279790.2518659949399951No Hit
AACTCCAGTCACGGTAGCATCTC267820.24109064214171164RNA PCR Primer, Index 24 (100% over 23bp)
TGTCTGAGGGTCGCT266240.23966833158020054No Hit
ACTGGACAACTCTTAGCGG264260.23788594239552205No Hit
GAGAGAGGCATGATCGTAGC263210.23694073600970772No Hit
GTTTCCGTAGTGTAGTGGTTATC260410.23442018564753614No Hit
TGAGGTAGTAGGTTGTATAGT255350.2298651910644689No Hit
TGGAGTGTGACAATGGTGTTTG251650.22653446380017078No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTG242940.21869375178070133No Hit
GAGAGAGGCATGATCGTAGCGAT235420.2119242736651548No Hit
TGAGATGAAGCACTGTAGCTC231510.20840450512369374No Hit
GTTCAGGTCGCAGTCTC230760.20772935770525494No Hit
TTCCAGTGATGACAGCCTATAATCTGACT229880.20693718473428674No Hit
GCCGTGATCGTATAGTGGTTAGTACTCT222120.19995165944483978No Hit
CGTTCGCGCTCTCCCCTG219690.197764181809098No Hit
GAGAGAGGCATGATCGTAGCG219480.19757514053193515No Hit
GGCTTTGGTCTAGGGGTATGATTCT213730.19239901032390422No Hit
CATTATTACTTTTGGTACGCG209940.18898726536939342No Hit
AACTGGACAACTCTTAGCGG207820.18707884866660635No Hit
TGTAAACATCCCCGACTGGAAGCT202880.18263187767048936No Hit
TCCCATATGGTCTAGCGGTTAGGATTC201210.18112854941876558No Hit
TGAGGTAGTAGATTGAATAGTT200720.18068745310538556No Hit
TGAGATGAAGCACTGTAGCTCT200090.18012032927389696No Hit
GTTGTCGTGGCC198730.1788960619551279No Hit
AACTCCAGTCACGGTAGCATCTCG197640.17791484770699684RNA PCR Primer, Index 24 (100% over 24bp)
GAGAGAGGCATGATCGTAGCGATAACT196510.176897625596549No Hit
GGGAATACCAGGTGCTGTAAGCTT193870.17452110668364437No Hit
GTTCCTGTAGTGTAGTGGTTATCACGTTC193570.17425104771626884No Hit
TGCAAACGAGCGCTGAC192540.17332384526161287No Hit
TACGCCTGTCTGAGGGTCGCT189020.17015515337774004No Hit
ATGACCTATGAATTGACAGCCAT183960.16560015879467282No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGG181490.16337667329661432No Hit
AGTAGAGTCAGCT179100.16122520352318928No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTC176830.15918175733671447No Hit
ACAGTAGTCTGCACATTGGTT174430.15702128559771025No Hit
AAACCGTTACCATTACTGAGTTT171000.15393361140405007No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCG170670.153636546539937No Hit
GGCTTGGTCTAGGGGTATGATTCTC166660.15002675834268414No Hit
AACTCCAGTCACGGTAGCATCTCGTATGC164830.14837939864169342RNA PCR Primer, Index 24 (100% over 29bp)
TGAGGTAGTTGGTTGTATTGTT164060.14768624729209623No Hit
GTTGTCGTGGCCGAGTGGTTAAG163180.14689407432112803No Hit
CATTGCACTTGTCTCGGTCTGA162000.14583184238278427No Hit
TAGCTTATCAGACTGGTGTTGG161020.14494964975602423No Hit
GCATTGTGGTTCAGTGGTAGAATTC154570.1391433819574504No Hit
TACGACCTCAGATCAGACGAGACAACC151780.136631833560858No Hit
TGAGGTAGTAGTTTGTGCTGTT147190.13249993136001245No Hit
ATGACCTATGAATTGACAGC145650.13111362866081808No Hit
TCGTACCGTGAGTAATAATGCA141280.1271797697027146No Hit
AACCCGTAGATCCGAACTTGTG139610.12567644145099083No Hit
CCTCGATCCAAGTTTTTGT136440.12282281836238944No Hit
TGTAAACATCCTACACTCAGCT135840.12228270042763838No Hit
TGAGATGAAGCACTGTAGCT129310.11640441690443108No Hit
GAAGGATCATTA126380.11376684098973011No Hit
ATGACCTATGAATTGACAGCCT125690.1131457053647664No Hit
GGTTCCATGGTGTAATGGTTAGCACTCTG124920.11245255401516922No Hit
CTCGATCCAAGTTTTTGT124510.11208347342642266No Hit
GAGAGAGGCATGATCGTAGCGATAACTG124010.11163337514746344No Hit
CACTCCAGTCACGGTAGCATCT122660.11041810979427358RNA PCR Primer, Index 24 (95% over 22bp)
TGGACAACTCTTAGCGG121080.10899579923276247No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATG118840.10697935894302521No Hit
TGAGGTAGTAGGTTGTGTGGTT117520.10579109948657289No Hit
GTTCGCGCTCTCCCCTG114230.10282945281102128No Hit
TCCCCTGTGGTCTAGTGGTTAGGATTCG112620.10138013635277263No Hit
TCCCTGTGGTCTAGTGGTTAGGATTTG111790.10063297320970033No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCCT277350.0148.7396523
ATTCGGC106850.0143.7038423
CAACCCG11400.0142.6223923
CGTATGC22950.0133.3767523
TTAGGTA4050.0131.0875423
TCTCGCC89450.0121.3935923
AGCATGC5250.0118.5054823
CATAGCT54300.0113.6605123
CACGTCT15850.0107.8138323
AATAACC4400.0101.80698423
TAACTGC6050.0101.46419523
ATGCAAG5400.096.7794823
CACTTTC2800.094.8043923
GGCAATG5550.092.6691623
ATTCCTG14000.091.2492223
CCCGCCT9300.090.0896523
AGCATCC2800.088.8791223
ATTTGGC9200.082.9538423
AGTATTT4400.081.0685323
TTAGGTC2150.081.0246823