FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_14_JG71_3_ACTGAT_L004_R1_001_TRIMMED_prinseq_good_hDLx.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_14_JG71_3_ACTGAT_L004_R1_001_TRIMMED_prinseq_good_hDLx.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5872087
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC4503537.669385688597598No Hit
ATGACCTATGAATTGACAGCCA3569886.079405839865792No Hit
TTCAAGTAATCCAGGATAGGCT2794524.758989435953521No Hit
CCTGTCTGAGGGTCGCT2266693.86010970205312No Hit
TGAGGTAGTAGGTTGTATAGTT1853763.1569014559900084No Hit
AAGCTGCCAGCTGAAGAACTGT1193942.033246442023083No Hit
TAGCTTATCAGACTGGTGTTGGC1031221.7561388310493358No Hit
AACATTCAACGCTGTCGGTGAGT756171.28773637039097No Hit
TATTGCACTTGTCCCGGCCTGT748241.2742318020833139No Hit
AACATTCAACGCTGTCGGTGAG720261.226582644296653No Hit
CTACGCCTGTCTGAGGGTCGCT689341.1739267487011007No Hit
TCAGTAACTGGAATCTGTCCCT605611.0313368994703247No Hit
TGTAAACATCCTTGACTGGAAGCT557220.9489300822688765No Hit
CTGTCTGAGGGTCGCT537640.9155858896504769No Hit
TGAGGTAGTAGTTTGTATAGTT513650.8747315903187401No Hit
AACTCCAGTCACACTGATATCTCGTATGC451160.7683128672991391TruSeq Adapter, Index 25 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCG450840.7677679162451101No Hit
TTCACAGTGGCTAAGTTCTG437880.7456973985569356No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC431550.7349175855194244No Hit
TGTCTGAGGGTCGCT425520.7246486640950653No Hit
CCACGTTCCCGTGG387180.6593567159342155No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT381140.649070764789418No Hit
TTCAAGTAATCCAGGATAGGTT361270.6152327102783047No Hit
TGGAGTGTGACAATGGTGTTTG346300.5897392187820105No Hit
TGTAAACATCCTACACTCTCAGCT345300.5880362467381699No Hit
TTCACAGTGGCTAAGTTCTGC331130.5639051328769482No Hit
GGACAACTCTTAGCGG323720.5512861100320892No Hit
GAGAGAGGCATGATCGTAGCGATA306760.522403704168552No Hit
TGAGGTAGTAGATTGAATAGTT258190.4396903519992125No Hit
TGAGATGAAGCACTGTAGCTC257280.4381406474393176No Hit
AACTCCAGTCACACTGATATCT252170.4294384602952919TruSeq Adapter, Index 25 (100% over 22bp)
TTCACAGTGGTTAAGTTCTG243800.41518458428834587No Hit
CTGGACAACTCTTAGCGG242920.41368596888976605No Hit
TGAGGTAGTAGTTTGTGCTGTT238100.4054776436384543No Hit
TACGCCTGTCTGAGGGTCGCT226960.38650653507006966No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG217950.37116275695506556No Hit
TGTAAACATCCCCGACTGGAAGCT215310.3666669107593263No Hit
TGAGATGAAGCACTGTAGCTCT211850.3607746274876377No Hit
ATGACCTATGAATTGACAGCCAT210290.3581179910992463No Hit
ACAGTAGTCTGCACATTGGTT208980.3558870977218151No Hit
CCTGTCTGAGGGTCGCTT207020.35254927251588747No Hit
GAGAGAGGCATGATCGTAGCGAT194420.3310918247634955No Hit
GAGAGAGGCATGATCGTAGCG193020.3287076639021186No Hit
TGAGGTAGTAGGTTGTATAGT184990.31503279839007836No Hit
TGAGGTAGTAGGTTGTATAGTTT180650.30764189971981004No Hit
CATTATTACTTTTGGTACGCG171610.2922470324434907No Hit
TACCCTGTAGATCCGGATTTGT167030.2844474204827006No Hit
GAGAGAGGCATGATCGTAGC161510.2750470148007003No Hit
TACCCTGTAGAACCGAATTTGT156270.2661234412909754No Hit
GCATTGGTGGTTCAGTGGTAGAATTCT155670.265101658064671No Hit
GCATGTGGTTCAGTGGTAGAATTCTCGCC155100.2641309639996819No Hit
TTCCAGTGATGACAGCCTATAATCTGACT153260.2609974954390151No Hit
GAGAGAGGCATGATCGTAGCGATAACT151860.25861333457763824No Hit
AACATTCAACGCTGTCGGTGA149530.2546454097154896No Hit
ACTGGACAACTCTTAGCGG148170.25232936773586634No Hit
AACTCCAGTCACACTGATATCTC146380.24928104777739157TruSeq Adapter, Index 25 (100% over 23bp)
CATTGCACTTGTCTCGGTCTGA145450.24769728377661981No Hit
TACCCTGTAGATCCGGATTTGTG144330.2457899550875183No Hit
TATTGCACTTGTCCCGGCCTGTT143340.24410401276411606No Hit
GAGAGAGGCATGATCGTAGCGATAAC140820.23981252321363766No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC138300.23552103366315927No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGC133390.22715944092790177No Hit
AACTGGACAACTCTTAGCGG132700.22598439021765176No Hit
TCAGTAACTGGAATCTGTCCCTGC132480.22560973636800682No Hit
TGGAGTGTGACAATGGTGTTTGT129730.22092656324744506No Hit
TAGCTTATCAGACTGGTGTTGG128460.2187637887517675No Hit
TTCAAGTAATCCAGGATAGGC127830.21769091636414786No Hit
TCGTACCGTGAGTAATAATGCA126080.21471071528742675No Hit
TACCCTGTAGAACCGAATTTGCG118830.20236416796958218No Hit
ATGACCTATGAATTGACAGC118630.20202357356081407No Hit
AACTCCAGTCACACTGATATCTCG118210.20130832530240098TruSeq Adapter, Index 25 (100% over 24bp)
TTCAAGTAATCCAGGATAGGCTT116060.19764693540814363No Hit
AACCCGTAGATCCGAACTTGTG114930.19572257699860376No Hit
TGAGAACTGAATTCCATAGATGG113230.19282752452407467No Hit
TGTAAACATCCTACACTCAGCT112790.19207821682478476No Hit
AACTCCAGTCACACTGATATCTCGTAT112280.19120970108242605TruSeq Adapter, Index 25 (100% over 27bp)
AGTAGAGTCAGCT109810.1870033601341397No Hit
TGTAAACATCCCCGACTGGAAGC107530.18312058387418306No Hit
TGTAACAGCAACTCCATGTGGA106900.18204771148656346No Hit
TGAGATGAAGCACTGTAGCT104770.17842038103318292No Hit
TCAGTAACTGGAATCTGTCCCTG104160.17738156808644012No Hit
GAGAGAGGCATGATCGTAGCGATAACTG101870.1734817621060451No Hit
TCCAGTGATGACAGCCTATAATCTGACT100590.17130195788992908No Hit
AGCTACATCTGGCTACTGGGTCTC99950.17021205578187107No Hit
ATGACCTATGAATTGACAGCCT95840.1632128406816861No Hit
TATTGCACTTGTCCCGGCCTGTAT92740.15793362734578012No Hit
TATTGCACTTGTCCCGGCCTGTA92020.1567074874742149No Hit
TCGTACCGTGAGTAATAATGC91060.15507263431212787No Hit
TAACGGAACCCATAATGCAGCTG90860.15473203990335974No Hit
TGAGGTAGTAGGTTGTGTGGTT88820.15125797693392484No Hit
CGCCTGTCTGAGGGTCGCT88750.151138768890856No Hit
TATTGCACTTGTCCCGGCCTGTTT88410.15055975839595018No Hit
TTCACAGTGGCTAAGTTCTGCT87910.1497082723740299No Hit
CAGTCGGTAGAGCATC86760.14774985452361314No Hit
TTCACAGTGGTTAAGTTCTGC86450.14722193319002255No Hit
GTTGTCGTGGCCGA86290.14694945766300804No Hit
TGTAAACATCCTTGACTGGAAGC85080.1448888614899609No Hit
AAGCTGCCAGCTGAAGAACT85070.14487183176952248No Hit
GAAGGATCATTA82750.14092093662781222No Hit
TACGACCTCAGATCAGACGAGACAACC82200.13998430200369988No Hit
ACAGTAGTCTGCACATTGGTTA82000.13964370759493175No Hit
AACAGTAAGAGTTTATGTGCTG79050.1346199400656019No Hit
TCACAGTGAACCGGTCTCTTT78010.13284884914000764No Hit
TGTAAACATCCCCGACTGGA77580.13211657116115616No Hit
TGAGGTAGTTGTTTGTACAGTT74700.12721201167489515No Hit
TATTGCACTTGTCCCGGCCTGTAA72710.12382309730765229No Hit
TGAGGTAGTTGGTTGTATTGTT71960.12254586827477182No Hit
TGGAGTGTGACAATGGTGTTT70070.11932725111191303No Hit
TGAGGTAGTAAGTTGTGTTGTT67040.1141672458190759No Hit
TTTTGCAGAAACGTTTCAGATT66960.11403100805556865No Hit
TACAGTACTGTGATAACTGAAG66350.11299219510882588No Hit
AACATTCATTGCTGTCGGTGGG65980.11236209545260484No Hit
TTCACAGTGGTTAAGTTCTGCC64400.10967139962333665No Hit
AACATTCATTGCTGTCGGTGGGT63470.10808763562256485No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTC63170.10757674400941268No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGC62560.10653793106266989No Hit
GGCCGTGATCGTATAGTGGTTAGTACTCT62480.10640169329916263No Hit
TAGCTTATCAGACTGGTGTTGGCT62450.10635060413784742No Hit
GTTCAGGTCGCAGTCTC61550.10481792929839084No Hit
TACCCTGTAGAACCGAATTTGC61510.10474981041663721No Hit
CACCACGTTCCCGTGG61280.10435812684655386No Hit
CTACGCCTGTCTGAGGGTCGCTT59830.10188881738298496No Hit
TACGACCTCAGATCAGACGA59800.10183772822166975No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC50050.0336.2643723
GATTCCT44600.0326.471123
TATCGCC450.0322.7622423
CAACCCG2200.0280.5830423
TTAGGTA1050.0276.6533523
TCTCGCC24750.0275.0814523
AATAACC1000.0272.3306323
TAACTGC4200.0259.3625223
ACTTCCC150.0015296119242.0716723
AGTATTT750.0242.0716723
CATAGCT1950.0232.761223
ATTCGGC22900.0229.9152423
TATGCCG2700.0201.726423
TTATCGC400.0196.3819722
AGGCAAT800.0196.3819722
GTACTCT17850.0191.2162823
ATAACTA2750.0189.240822
GGCAATG1550.0187.4103423
ATCGGGC200.003618273181.5537723
TAACTAA406.945338E-7181.5537723