FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_14_JG73_3_GTTTCG_L008_R1_001_TRIMMED_prinseq_good_H7pm.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_14_JG73_3_GTTTCG_L008_R1_001_TRIMMED_prinseq_good_H7pm.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10096571
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC7663377.590071916495214No Hit
ATGACCTATGAATTGACAGCCA6459186.397399671631092No Hit
TTCAAGTAATCCAGGATAGGCT5351365.30017567350341No Hit
CCTGTCTGAGGGTCGCT4944324.897028902188674No Hit
TGAGGTAGTAGGTTGTATAGTT3137303.10729256497082No Hit
AAGCTGCCAGCTGAAGAACTGT2462192.4386398114765893No Hit
TCAGTAACTGGAATCTGTCCCT1968521.949691632931616No Hit
CTACGCCTGTCTGAGGGTCGCT1754201.7374215463844112No Hit
TAGCTTATCAGACTGGTGTTGGC1630351.6147561384949403No Hit
AACATTCAACGCTGTCGGTGAGT1366151.353083140800971No Hit
AACATTCAACGCTGTCGGTGAG1312281.2997283929365722No Hit
TGTAAACATCCTTGACTGGAAGCT1243011.2311209419514804No Hit
TATTGCACTTGTCCCGGCCTGT1190481.1790933773456354No Hit
CTGTCTGAGGGTCGCT1086311.0759197355220895No Hit
TGAGGTAGTAGTTTGTATAGTT910220.9015139892543717No Hit
TGTCTGAGGGTCGCT864410.8561421496466474No Hit
TGAGATGAAGCACTGTAGCTC748460.7413011803710389No Hit
TGTAAACATCCTACACTCTCAGCT709480.7026940136408688No Hit
TGAGATGAAGCACTGTAGCTCT695320.6886694502519717No Hit
TTCAAGTAATCCAGGATAGGTT658640.6523402846372298No Hit
TTCACAGTGGCTAAGTTCTG634320.6282528989297456No Hit
TGGAGTGTGACAATGGTGTTTG579740.5741949420253668No Hit
TTCACAGTGGCTAAGTTCTGC553370.5480771640193487No Hit
TCAGTAACTGGAATCTGTCCCTGC548180.5429368049806216No Hit
CCACGTTCCCGTGG505040.5002094275373292No Hit
TACGCCTGTCTGAGGGTCGCT489970.48528356805493666No Hit
ACAGTAGTCTGCACATTGGTT456100.4517375255420875No Hit
TTCACAGTGGTTAAGTTCTG447030.4427542776651598No Hit
ATGACCTATGAATTGACAGCCAT417770.41377414173584276No Hit
TGTAAACATCCCCGACTGGAAGCT415970.4119913582542033No Hit
GGACAACTCTTAGCGG401680.3978380382805212No Hit
CATTATTACTTTTGGTACGCG393990.39022159107285037No Hit
TCAGTAACTGGAATCTGTCCCTG390820.38708191127462976No Hit
TGAGGTAGTAGTTTGTGCTGTT378650.3750283140682119No Hit
TTCCAGTGATGACAGCCTATAATCTGACT376120.3725225128412409No Hit
CTGGACAACTCTTAGCGG371830.36827354554333347No Hit
AACTCCAGTCACGTTTCGATCT366250.3627469167502511TruSeq Adapter, Index 21 (95% over 22bp)
TGAGGTAGTAGGTTGTATAGTTT366060.3625587340494114No Hit
TGAGGTAGTAGGTTGTATAGT337910.33467798126710546No Hit
TGAGGTAGTAGATTGAATAGTT330160.32700210794337997No Hit
AACATTCAACGCTGTCGGTGA322490.31940546944106074No Hit
TCGTACCGTGAGTAATAATGCA317960.31491879767893477No Hit
TGAGATGAAGCACTGTAGCT305150.3022313219012673No Hit
CATTGCACTTGTCTCGGTCTGA303220.3003197818348427No Hit
TCCAGTGATGACAGCCTATAATCTGACT287180.28443320014289997No Hit
AACCCGTAGATCCGAACTTGTG284790.28206605985338984No Hit
ATGACCTATGAATTGACAGC284160.281442085634816No Hit
CCTGTCTGAGGGTCGCTT264270.2617423281627No Hit
ACTGGACAACTCTTAGCGG253350.25092677504075395No Hit
TTCAAGTAATCCAGGATAGGCTT242130.23981409133853465No Hit
TTCAAGTAATCCAGGATAGGC239480.23718943787945432No Hit
TGTAAACATCCTACACTCAGCT239260.23697154212058727No Hit
TACCCTGTAGATCCGGATTTGT235230.23298008799225003No Hit
TGGAGTGTGACAATGGTGTTTGT231400.22918672091742828No Hit
TATTGCACTTGTCCCGGCCTGTT229210.22701766768143364No Hit
AACTCCAGTCACGTTTCGATCTCGTATGC219350.2172519759431197TruSeq Adapter, Index 21 (96% over 29bp)
TGTAAACATCCCCGACTGGAAGC218800.21670723654595211No Hit
ATGACCTATGAATTGACAGCCT214510.2124582692480447No Hit
TGTAACAGCAACTCCATGTGGA207540.20555493543302966No Hit
AAGCTGCCAGCTGAAGAACT204720.20276190797846122No Hit
AACTGGACAACTCTTAGCGG204100.20214783811256318No Hit
TGTAAACATCCTTGACTGGAAGC195050.193184398940987No Hit
CCTCGATCCAAGTTTTTGT192540.19069840641936753No Hit
TGTAAACATCCCCGACTGGA187850.18605326501442915No Hit
TCGTACCGTGAGTAATAATGC187180.18538967338515225No Hit
AACTCCAGTCACGTTTCGATCTC186910.18512225586290632TruSeq Adapter, Index 21 (95% over 23bp)
TACCCTGTAGATCCGGATTTGTG183700.18194295865398263No Hit
TAGCTTATCAGACTGGTGTTGG183570.18181420206919754No Hit
CGCCTGTCTGAGGGTCGCT182600.1808534798596474No Hit
GAAGGATCATTA175240.17356387629027717No Hit
TGGAGTGTGACAATGGTGTTT172980.17132549258555207No Hit
TACCCTGTAGAACCGAATTTGT170820.16918615240758472No Hit
TTCACAGTGGTTAAGTTCTGC168770.1671557601090509No Hit
ACAGTAGTCTGCACATTGGTTA165940.1643528283018066No Hit
CAGTCGGTAGAGCATC162990.16143104426245306No Hit
GAATACCAGGTGCTGTAAGCTT160140.15860830374985724No Hit
TATTGCACTTGTCCCGGCCTGTAT149020.14759466357439568No Hit
AACTCCAGTCACGTTTCGATCTCG148780.14735695911017713TruSeq Adapter, Index 21 (95% over 24bp)
TTTTGCAGAAACGTTTCAGATT148130.14671317618625174No Hit
TATTGCACTTGTCCCGGCCTGTTT143860.14248401759369592No Hit
TATTGCACTTGTCCCGGCCTGTA142190.14082999069684154No Hit
GGAATACCAGGTGCTGTAAGCTT139650.13831428511719474No Hit
TGAGAACTGAATTCCATAGATGG136780.13547173589924738No Hit
CTCGATCCAAGTTTTTGT136560.13525384014038033No Hit
TCACAGTGAACCGGTCTCTTT136000.13469919639053696No Hit
TTCACAGTGGCTAAGTTCTGCT134610.13332249136860425No Hit
TAACGGAACCCATAATGCAGCTG132710.13144066436020704No Hit
TACAGTACTGTGATAACTGAAG122420.1212490854568348No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT122110.12094205052388578No Hit
TGAGGTAGTAAGTTGTGTTGTT121210.12005065878306605No Hit
TGAGGTAGTTGTTTGTACAGTT120760.11960496291265618No Hit
TACCCTGTAGAACCGAATTTGCG118100.1169704051009001No Hit
TGTAAACATCCTACACTCTCAGC116870.11575216972177979No Hit
CACGTTCCCGTGG116080.11496972586039358No Hit
TGAGGTAGTAGGTTGTGTGGTT112670.1115923415979544No Hit
TGGACAACTCTTAGCGG109270.10822486168819098No Hit
TTCACAGTGGTTAAGTTCTGCC109110.10806639204537859No Hit
TAGCTTATCAGACTGGTGTTGGCT107510.10648169561725462No Hit
GCTACGCCTGTCTGAGGGTCGCT107030.10600628668881741No Hit
TCCCTGAGACCCTAACTTGTGA106440.1054219298809467No Hit
GTACAGTACTATGATAACTGAA106360.1053426950595405No Hit
TGAGGTAGTTGGTTGTATTGTT106210.1051941297694039No Hit
TACAGTACTATGATAACTGAA103020.10203464126583173No Hit
AAGTTCTGTGATACACTCAGACT102330.10135124093120326No Hit
AAACCGTTACCATTACTGAGTTT102230.10125219740444553No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCAAGT106.4297274E-5697.128923
ACATAGC152.3300345E-7697.1288523
TAACTGC3050.0639.987123
CGTATGC27450.0628.5588423
CAACCCG5750.0588.0130623
AATAACC2700.0542.2113623
GCCCACA550.0507.002823
GAGCGCA152.1677019E-4464.752623
TAACTAA152.1677019E-4464.752623
GATTCCT7850.0430.7101723
AGTATTT251.7937455E-6418.2773423
GCTTCCT1000.0418.2773423
CCCGTTC451.03682396E-10387.2938223
ATAACTA3650.0364.8322422
ACAACCC13500.0354.5315622
AAATAGC5050.0352.0155623
TCGTATG28100.0346.147522
ATCACTA351.8189894E-12330.8416722
TAATAGG651.8189894E-12321.751823
TAATAAC3100.0311.2757322