FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_5_JG17_3_ACAGTG_L004_R1_001_TRIMMED_prinseq_good_6yPr.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_5_JG17_3_ACAGTG_L004_R1_001_TRIMMED_prinseq_good_6yPr.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5366316
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC4129687.695558740856856No Hit
ATGACCTATGAATTGACAGCCA4010167.472836113266531No Hit
AACTCCAGTCACACAGTGATCTCGTATGC2837645.287873468502414Illumina PCR Primer Index 5 (100% over 29bp)
CCTGTCTGAGGGTCGCT2283354.254967467439488No Hit
TTCAAGTAATCCAGGATAGGCT1461852.7241220979159633No Hit
TAGCTTATCAGACTGGTGTTGGC1460822.7222027178421846No Hit
TGAGGTAGTAGGTTGTATAGTT1208312.2516564436384288No Hit
AAGCTGCCAGCTGAAGAACTGT1101482.0525813239473787No Hit
TCAGTAACTGGAATCTGTCCCTGC956231.7819114640285811No Hit
TGAGATGAAGCACTGTAGCTC852561.5887249278648516No Hit
AACATTCAACGCTGTCGGTGAG810211.5098067277439495No Hit
AACATTCAACGCTGTCGGTGAGT778741.45116314432471No Hit
TATTGCACTTGTCCCGGCCTGT720841.343267895517148No Hit
TCAGTAACTGGAATCTGTCCCT697331.2994575794641985No Hit
TGTAAACATCCTTGACTGGAAGCT674891.2576411825170193No Hit
CTACGCCTGTCTGAGGGTCGCT609051.134949935859163No Hit
TGAGGTAGTAGTTTGTATAGTT542301.0105629262235023No Hit
TGAGATGAAGCACTGTAGCTCT518110.9654854466266988No Hit
CTGTCTGAGGGTCGCT511340.9528697154621532No Hit
TGTCTGAGGGTCGCT492890.9184885869561167No Hit
GGACAACTCTTAGCGG477650.8900892157673905No Hit
TGTAAACATCCTACACTCTCAGCT469250.874436019049195No Hit
TCAGTAACTGGAATCTGTCCCTG297090.5536200253581787No Hit
CTGGACAACTCTTAGCGG277710.5175058643583419No Hit
TTCACAGTGGCTAAGTTCTGC270650.5043497252118586No Hit
TACGCCTGTCTGAGGGTCGCT248980.46396820463051375No Hit
TGAGGTAGTAGATTGAATAGTT225170.41959884583762863No Hit
TGGAGTGTGACAATGGTGTTTG220160.4102628320807049No Hit
CCTGTCTGAGGGTCGCTT214590.3998832718759015No Hit
TTCAAGTAATCCAGGATAGGTT209230.3898950415890529No Hit
TTCACAGTGGCTAAGTTCTG205790.3834846848377919No Hit
TGTAAACATCCCCGACTGGAAGCT200830.37424184487085743No Hit
AACTCCAGTCACACAGTGATCT191370.3566133638048896Illumina PCR Primer Index 5 (100% over 22bp)
AACATTCAACGCTGTCGGTGA189910.35389268913720323No Hit
AACTGGACAACTCTTAGCGG180680.33669280750518604No Hit
CCACGTTCCCGTGG172350.3211700540929755No Hit
CATTATTACTTTTGGTACGCG168780.31451744548774246No Hit
ACTGGACAACTCTTAGCGG167610.3123371788019938No Hit
TACCCTGTAGATCCGGATTTGTG166430.3101382773582473No Hit
TACCCTGTAGATCCGGATTTGT162300.30244212230513445No Hit
TGAGGTAGTTGGTTGTATAGTT159900.29796978038565003No Hit
AACCCGTAGATCCGAACTTGTG155540.28984502589858663No Hit
TTCACAGTGGTTAAGTTCTG148360.27646526965612905No Hit
TGAGGTAGTAGTTTGTGCTGTT145490.2711170941107456No Hit
AACTCCAGTCACACAGTGATCTC143840.2680423590411001Illumina PCR Primer Index 5 (100% over 23bp)
TCGTACCGTGAGTAATAATGCA136610.2545694290086532No Hit
ACAGTAGTCTGCACATTGGTT133300.2484013241113643No Hit
TGAGATGAAGCACTGTAGCT129670.2416369069581441No Hit
TGTAACAGCAACTCCATGTGGA123270.22971066183951894No Hit
CATTGCACTTGTCTCGGTCTGA121490.22639367491590132No Hit
ATGACCTATGAATTGACAGCCAT121040.225555110805998No Hit
ATGACCTATGAATTGACAGC114200.21280893633546738No Hit
TACCCTGTAGAACCGAATTTGT108420.20203804621270904No Hit
TATTGCACTTGTCCCGGCCTGTT106240.19797566896917737No Hit
TAGCTTATCAGACTGGTGTTGG105240.19611219316939218No Hit
CGCCTGTCTGAGGGTCGCT104380.19450960398157693No Hit
AAGTTCTGTGATACACTCAGACT103130.19218025923184545No Hit
GCATGAGTGACTGGTTAATCTTT102680.19134169512194213No Hit
TCCCTGTTCGGGCGCCA95440.17785013033149744No Hit
TCCCTGAGACCCTTAACCTGTGA95000.17703020097959196No Hit
TTCACAGTGGTTAAGTTCTGC92270.17194291204617843No Hit
TCACAGTGAACCGGTCTCTTT91300.17013534052038679No Hit
TGTAAACATCCTACACTCAGCT90000.16771282198066606No Hit
TGGACAACTCTTAGCGG89590.16694879690275416No Hit
TGAGGTAGTTGTTTGTACAGTT86440.16107884813343082No Hit
AGCTACATCTGGCTACTGGGTCTC84200.15690466234191203No Hit
CACCACGTTCCCGTGG83800.15615927202199797No Hit
TACCCTGTAGAACCGAATTTGCG82890.15446350904419345No Hit
TGGAGTGTGACAATGGTGTTTGT82580.15388583154626004No Hit
TGTAAACATCCCCGACTGGAAGC81200.1513142349425565No Hit
TTCACAGTGGTTAAGTTCTGCC78790.14682325826507422No Hit
TGTAAACATCCTTGACTGGAAGC78210.14574244230119882No Hit
TGAGGTAGTAGGTTGTATAGTTT77800.1449784172232869No Hit
AACTCCAGTCACACAGTGATCTCG77220.14389760125941148Illumina PCR Primer Index 5 (100% over 24bp)
AACATTCATTGCTGTCGGTGGG76520.14259316819956186No Hit
CCTCGATCCAAGTTTTTGT75350.1404129015138132No Hit
TGAGGTAGTAGGTTGTATAGT74720.13923891175994854No Hit
TCAGTGCATTACAGAACTTTGT74710.1392202770019507No Hit
AAGTTCTGTGATACACTTTGACT71840.13387210145656722No Hit
ATGACCTATGAATTGACAGCCT71090.13247449460672833No Hit
ACAGTCCGACGATC70930.13217633847876273Illumina DpnII expression Sequencing Primer (100% over 14bp)
AGTTCTACAGTCCGACGATC68580.12779717034926755No Hit
AAGCTGCCAGCTGAAGAACT65610.12226264722390556No Hit
AACATTCATTGCTGTCGGTGGGT65540.12213220391792061No Hit
TAACGGAACCCATAATGCAGCTG65380.12183404778995496No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT64990.12110729222803876No Hit
AACTCCAGTCACACAGTGATCTCGTAT64320.11985876344218269Illumina PCR Primer Index 5 (100% over 27bp)
GAAGGATCATTA62030.11559140386067461No Hit
TACGACCTCAGATCAGACGAGACAACC61630.11484601354076054No Hit
TGAGAACTGAATTCCATAGATGG61410.11443604886480781No Hit
TACGACCTCAGATCAGACGAGACAACCC61190.11402608418885507No Hit
TCAGTAACTGGAATCTGTCCCTGCA61120.11389564088287012No Hit
TACGACCTCAGATCAGACGAGA61040.11374656281888729No Hit
CTACAGTCCGACGATC60370.11249803403303124Illumina DpnII expression Sequencing Primer (100% over 16bp)
TTTTGCAGAAACGTTTCAGATT60030.11186445226110425No Hit
AGAGTTCTACAGTCCGACGATC59410.11070909726523745Illumina DpnII expression Sequencing Primer (100% over 22bp)
TAGCTTATCAGACTGGTGTTGGCT58110.10828657872551672No Hit
TGAGGTAGTAAGTTGTGTTGTT56950.10612494679776592No Hit
CAGAGTTCTACAGTCCGACGATC56600.10547273026784111Illumina DpnII expression Sequencing Primer (100% over 23bp)
TAGTTCTACAGTCCGACGATC56000.10435464478796999Illumina DpnII expression Sequencing Primer (95% over 21bp)
TAATACTGTCTGGTAATGCCG55680.10375833253203873No Hit
TATTGCACTTGTCCCGGCCTGTTT55190.10284522939014401No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTATTCC100.0020135976220.8458323
TAACTGC800.0220.8458323
CGTATGC302600.0215.8465123
CAACCCG3700.0191.0018223
TCGTATG304500.0180.7880922
ACAACCC11100.0177.4223522
ATAACTA700.0172.5205222
GATTCCT6650.0162.728523
GATAACA201.2345208E-6161.7843821
TTTCGCC100.0051097525161.7843821
AATGCTC4450.0158.6532722
CTCGTAT314300.0155.3500721
GACAACC18350.0152.967821
AGCGCCT150.0067728744147.2305623
AATAACC455.838956E-10147.2305623
TAACTAA150.0067728744147.2305623
GCAACGA100.007029359145.4179120
TCTCGTA310150.0142.4640720
AGACAAC19700.0139.8816820
CAAAATA800.0136.3292820