FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_5_JG22_3_TGACCA_L005_R1_001_TRIMMED_prinseq_good_4awN.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_5_JG22_3_TGACCA_L005_R1_001_TRIMMED_prinseq_good_4awN.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7444996
Sequences flagged as poor quality0
Sequence length12-29
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GCATCGATGGTTCAGTGGTAGAATGCTC4934686.628183547714466No Hit
CCTGTCTGAGGGTCGCT3169124.256711487823499No Hit
ATGACCTATGAATTGACAGCC3107554.17401164486858No Hit
ATGACCTATGAATTGACAGCCA2529303.397315458597963No Hit
TCAGTAACTGGAATCTGTCCCT1789602.403762204842017No Hit
TGAGGTAGTAGGTTGTATAGTT1346411.8084764585501456No Hit
TTCAAGTAATCCAGGATAGGCT1335731.7941312527233058No Hit
TCAGTAACTGGAATCTGTCCCTGC1292701.736334042355429No Hit
CTACGCCTGTCTGAGGGTCGCT1257281.6887584627312089No Hit
TAGCTTATCAGACTGGTGTTGGC1191441.6003232238136864No Hit
AAGCTGCCAGCTGAAGAACTGT1114041.4963607770910823No Hit
AACATTCAACGCTGTCGGTGAGT787561.0578380431634886No Hit
AACATTCAACGCTGTCGGTGAG754941.0140233789245823No Hit
CTGTCTGAGGGTCGCT753431.0119951709846453No Hit
TGTCTGAGGGTCGCT724820.9735666748511349No Hit
TGAGATGAAGCACTGTAGCTC719860.9669044818828647No Hit
TGTAAACATCCTTGACTGGAAGCT596950.8018137283082489No Hit
TCCTCGGTAGTATAGTGGTCAGTATCCCC595960.8004839760827273No Hit
TATTGCACTTGTCCCGGCCTGT594800.7989258825659543No Hit
TCCTCGGTAGTATAGTGGTCAGTATCCC574030.7710279495113228No Hit
TGAGGTAGTAGTTTGTATAGTT559210.7511219616504831No Hit
TCAGTAACTGGAATCTGTCCCTG557290.7485430482434108No Hit
TGAGATGAAGCACTGTAGCTCT494200.6638015655078928No Hit
CTGGACAACTCTTAGCGG470870.6324650812438314No Hit
CCTGTCTGAGGGTCGCTT453290.6088519053603253No Hit
GGACAACTCTTAGCGG443290.5954200646984901No Hit
TACGCCTGTCTGAGGGTCGCT389940.5237611947675996No Hit
TGGAGTGTGACAATGGTGTTTG282420.37934204397154814No Hit
ACTGGACAACTCTTAGCGG276880.37190080424489147No Hit
AACTGGACAACTCTTAGCGG268280.36034942127571323No Hit
TTCACAGTGGCTAAGTTCTGC250280.33617210808441No Hit
TGAGGTAGTAGTTTGTGCTGTT248290.3334991717927048No Hit
TGTAAACATCCTACACTCTCAGCT239510.32170601569161356No Hit
AACTCCAGTCACTGACCAATCT226590.30435207755652255Illumina PCR Primer Index 4 (100% over 22bp)
CCACGTTCCCGTGG220850.2966422010166292No Hit
AACCCGTAGATCCGAACTTGTG216430.290705327444098No Hit
TGTAAACATCCCCGACTGGAAGCT215960.2900740309329918No Hit
AAGTTCTGTGATACACTCAGACT193550.25997327600981923No Hit
TTCAAGTAATCCAGGATAGGTT191590.25734063524009954No Hit
TTCACAGTGGCTAAGTTCTG182050.24452665924870878No Hit
CTACGCCTGTCTGAGGGTCGCTT177180.2379853528463951No Hit
CATTATTACTTTTGGTACGCG168450.226259355948613No Hit
TGAGATGAAGCACTGTAGCT166940.22423114800867588No Hit
AACTCCAGTCACTGACCAATCTCGTATGC159570.2143318814409034Illumina PCR Primer Index 4 (100% over 29bp)
AGGTCCCTTATCGGGC157110.21102764863809192No Hit
TCGTACCGTGAGTAATAATGCA149870.2013029959989233No Hit
TACCCTGTAGATCCGGATTTGT144660.1943050070141072No Hit
TGAGGTAGTAGATTGAATAGTT143100.19220963987086093No Hit
CGCCTGTCTGAGGGTCGCT142950.19200816226093337No Hit
ACAGTAGTCTGCACATTGGTT137820.18511762800141196No Hit
TTCACAGTGGTTAAGTTCTG137260.1843654449243492No Hit
GCATCGATGGTTCAGTGGTAGAATGC132150.17750177434615141No Hit
AACTCCAGTCACTGACCAATCTC129800.17434529179062017Illumina PCR Primer Index 4 (100% over 23bp)
GCATTGGTGGTTCAGTGGTAGAATTCTC124920.1677905535476446No Hit
TGGACAACTCTTAGCGG123550.1659503913769732No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT121450.16312970483798783No Hit
CATTGCACTTGTCTCGGTCTGA119170.1600672451670894No Hit
ATCGATGGTTCAGTGGTAGAATGCTC118580.15927476656804115No Hit
TACCCTGTAGATCCGGATTTGTG114930.15437214472647132No Hit
CTGTCTGAGGGTCGCTT110780.14879793085180973No Hit
AGCTACATCTGGCTACTGGGTCTC107710.14467435576862633No Hit
TCAGTGCATTACAGAACTTTGT106980.14369383140031236No Hit
TCAGTAACTGGAATCTGTCCCTGCA104300.14009409810294055No Hit
AGGTCAAGGGTTCATGTCCCTTATCGGGC104220.13998664337764588No Hit
TGAGGTAGTAGGTTGTATAGTTT103380.13885836876205174No Hit
CCTCGATCCAAGTTTTTGT102180.1372465478826315No Hit
AACATTCAACGCTGTCGGTGA101700.13660181953086342No Hit
AACTCCAGTCACTGACCAATCTCG101090.13578247725049147Illumina PCR Primer Index 4 (100% over 24bp)
TGTAAACATCCTACACTCAGCT100840.13544668123394557No Hit
ATGACCTATGAATTGACAGCCAT98570.13239765340370901No Hit
TAACGGAACCCATAATGCAGCTG98050.13169919768929358No Hit
AGGTCAAGGGTTCAGGTCCCTTATCGGGC97300.13069180963965596No Hit
TACCCTGTAGAACCGAATTTGCG96090.12906655691957392No Hit
TCCCTGTTCGGGCGCCA95250.12793828230397974No Hit
TGTCTGAGGGTCGCTT93770.12595036988602815No Hit
TTCCAGTGATGACAGCCTATAATCTGACT92890.12476836790778666No Hit
TGGAGTGTGACAATGGTGTTTGT89020.11957024557165646No Hit
TCGGTAGAGCATGAGACT88050.11826735702745844No Hit
TGAGGTAGTAGGTTGTATAGT87540.11758233315370485No Hit
TTCACAGTGGTTAAGTTCTGC87490.11751517395039567No Hit
GCATCGATGGTTCAGTGGTAGAATGCT86410.11606453515891747No Hit
AAGTTCTGTGATACACTTTGACT86330.1159570804336228No Hit
TACGACCTCAGATCAGACGAGA85830.11528548840053104No Hit
GAAGGATCATTA85510.11485566949935233No Hit
TCCCATATGGTCTAGTGGCTAGGATAGCT83580.11226332425161813No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT82380.11065150337219792No Hit
TGAGGTAGTTGGTTGTATAGTT82280.11051718496557957No Hit
TCAGTGCATTACAGAACTTTG81480.10944263771263274No Hit
TGAGGTAGTTGTTTGTACAGTT81080.10890536408615933No Hit
ACCGAGTTGGGCTTGGGT81060.10887850040483568No Hit
GAAATCTCAGCTGGCGACTGTG79830.10722638400342994No Hit
TATTGCACTTGTCCCGGCCTGTT79500.1067831332615894No Hit
TCCGGTATGGTCTAGGGGTTAGGATAGCT79090.10623242779445416No Hit
TGTAAACATCCCCGACTGGAAGC78900.10597722282187928No Hit
AAGCTGCCAGCTGAAGAACT78510.1054533810360677No Hit
TAGCTTATCAGACTGGTGTTGG78370.10526533526680201No Hit
GTGTAATGGTTAGCACTCTG77750.10443256114576825No Hit
TACGACCTCAGATCAGACGAGAC77630.10427137905782621No Hit
TACGCCTGTCTGAGGGTCGCTT77410.10397587856326586No Hit
ACCGAGTTGGGCTTGGGTGCT77280.103801264634662No Hit
TTCACAGTGGTTAAGTTCTGCC76910.1033042865301741No Hit
TACGACCTCAGATCAGA75650.10161187460678286No Hit
TCGTACCGTGAGTAATAATGC75510.10142382883751719No Hit
TACCCTGTAGAACCGAATTTGT75120.10089998705170561No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CACGTGT6750.0306.2895823
CGTATGC21150.0284.5844423
CAACCCG3350.0278.713223
TATCCCC83100.0253.2052323
GACCCCC1100.0242.5166623
TAACTGC1200.0236.2011423
GATTCCT18850.0231.7417423
AATAACC1400.0226.2767223
CAGGGCC1050.0222.3069623
ATGCTCG2350.0219.9419923
GACCCCA3550.0211.3481623
TACCCCC700.0190.5488123
AGCATGC800.0187.5714923
GATAGCT48300.0181.9188823
ATCGGGC58150.0168.307223
GATAGCG307.047364E-5166.7302223
TTCCACA200.004669061166.7302123
ATGACCG900.0166.7302123
TATCCTC401.0621516E-6166.7302123
CACGTCT9750.0157.3249223