FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_5_JG23_3_ATCACG_L008_R1_001_TRIMMED_prinseq_good_FSTV.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_5_JG23_3_ATCACG_L008_R1_001_TRIMMED_prinseq_good_FSTV.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8385803
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGTCTGAGGGTCGCT4601885.487703443546193No Hit
TTCAAGTAATCCAGGATAGGCT3964394.727501945848239No Hit
ATGACCTATGAATTGACAGCC3511714.1876848287516415No Hit
ATGACCTATGAATTGACAGCCA3460714.126867754942491No Hit
TGAGGTAGTAGGTTGTATAGTT2999973.5774391552007603No Hit
AAGCTGCCAGCTGAAGAACTGT2220122.6474745471602423No Hit
CTACGCCTGTCTGAGGGTCGCT1924592.2950574918108617No Hit
TAGCTTATCAGACTGGTGTTGGC1759782.0985229440758384No Hit
AACATTCAACGCTGTCGGTGAG1733442.067112714190877No Hit
AACATTCAACGCTGTCGGTGAGT1576201.8796053281957614No Hit
TATTGCACTTGTCCCGGCCTGT1510871.8016998491378822No Hit
TGAGGTAGTAGTTTGTATAGTT1268641.5128425983772813No Hit
TCAGTAACTGGAATCTGTCCCT1210521.4435349840677154No Hit
CTGTCTGAGGGTCGCT1174821.4009630324013096No Hit
TGTCTGAGGGTCGCT1173491.3993770185156984No Hit
TGTAAACATCCTTGACTGGAAGCT900671.07404144838604No Hit
CCACGTTCCCGTGG810960.9670630230641001No Hit
TGAGATGAAGCACTGTAGCTC787060.9385624727888312No Hit
TGTAAACATCCTACACTCTCAGCT725970.865713158298615No Hit
TGGAGTGTGACAATGGTGTTTG681560.8127546044189209No Hit
TCAGTAACTGGAATCTGTCCCTGC624610.7448422053320356No Hit
TACGCCTGTCTGAGGGTCGCT601480.7172598736221206No Hit
TTCAAGTAATCCAGGATAGGTT600210.7157454092351084No Hit
TTCACAGTGGCTAAGTTCTGC538590.6422640741739342No Hit
TGAGATGAAGCACTGTAGCTCT488390.5824009936794365No Hit
AACTCCAGTCACATCACGATCT487540.5813873757826173Illumina PCR Primer Index 1 (100% over 22bp)
CCTGTCTGAGGGTCGCTT458390.546626244379936No Hit
AACCCGTAGATCCGAACTTGTG457370.5454099029037529No Hit
GGACAACTCTTAGCGG455410.5430726192828522No Hit
CTGGACAACTCTTAGCGG437810.5220847663604785No Hit
TTCACAGTGGCTAAGTTCTG432010.5151683148292417No Hit
TCAGTAACTGGAATCTGTCCCTG431530.5145959188404498No Hit
AACTCCAGTCACATCACGATCTCGTATGC405460.48350766169918374Illumina PCR Primer Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTT364460.4346155043231996No Hit
TGTAAACATCCCCGACTGGAAGCT355710.42418120244417856No Hit
TCGTACCGTGAGTAATAATGCA328520.39175735466239786No Hit
TGAGGTAGTAGTTTGTGCTGTT324280.3867011900947351No Hit
CATTATTACTTTTGGTACGCG302480.36070487227043135No Hit
ACTGGACAACTCTTAGCGG301160.3591307833012533No Hit
GAAGGATCATTA290470.34638304763419797No Hit
TTCACAGTGGTTAAGTTCTG275210.3281856251571853No Hit
AACTCCAGTCACATCACGATCTCG268310.3199574328183002Illumina PCR Primer Index 1 (100% over 24bp)
TGAGGTAGTAGATTGAATAGTT264870.31585526156529076No Hit
CATTGCACTTGTCTCGGTCTGA263570.31430502242897906No Hit
TGAGGTAGTTGGTTGTATAGTT261880.3122897115517739No Hit
AACTGGACAACTCTTAGCGG255970.30524208593977226No Hit
TAGCTTATCAGACTGGTGTTGG255200.3043238673744184No Hit
AACTCCAGTCACATCACGATCTC245450.2926970738520807Illumina PCR Primer Index 1 (100% over 23bp)
TGAGGTAGTAGGTTGTATAGTTT243250.290073592236784No Hit
AACATTCAACGCTGTCGGTGA231640.2762287642578773No Hit
TGGAGTGTGACAATGGTGTTTGT231490.2760498905113798No Hit
TATTGCACTTGTCCCGGCCTGTT227120.27083870203008586No Hit
TTCCAGTGATGACAGCCTATAATCTGACT227110.2708267771136527No Hit
TGAGGTAGTAGGTTGTATAGT222110.26486431889706924No Hit
CGCCTGTCTGAGGGTCGCT213510.2546088907645458No Hit
TGTAAACATCCTACACTCAGCT208640.2488014564615935No Hit
TGAGATGAAGCACTGTAGCT195410.2330247920205137No Hit
TCACAGTGAACCGGTCTCTTT186960.22294823763448773No Hit
TGAGGTAGTAAGTTGTGTTGTT178180.21247816100616723No Hit
ATGACCTATGAATTGACAGCCAT174420.20799439242729645No Hit
CTACGCCTGTCTGAGGGTCGCTT168420.20083944256739636No Hit
TTCACAGTGGTTAAGTTCTGC165760.19766741479617395No Hit
TGAGGTAGTTGTTTGTACAGTT165260.19707116897451563No Hit
TTTTGCAGAAACGTTTCAGATT164500.19616487532559493No Hit
TGTAAACATCCCCGACTGGAAGC159600.19032166627334318No Hit
AAGGTCCAACCTCACATGTCCT155210.1850866279591829No Hit
AACATTCATTGCTGTCGGTGGG154390.18410878481166323No Hit
GGAATACCAGGTGCTGTAAGCTT154160.18383451173370038No Hit
TCGTACCGTGAGTAATAATGC153510.18305939216554454No Hit
AAACCGTTACCATTACTGAGTTT151620.18080558295967603No Hit
TTCACAGTGGTTAAGTTCTGCC151350.1804836102159805No Hit
AAGCTGCCAGCTGAAGAACT148020.17651261304373594No Hit
TCCAGTGATGACAGCCTATAATCTGACT147430.1758090429741791No Hit
TGAGGTAGTTAGTTGTGTTGTT147340.1757017187262806No Hit
TTCAAGTAATCCAGGATAGGCTT147170.17549899514691675No Hit
TTCAAGTAATCCAGGATAGGC147000.17529627156755292No Hit
ACAGTAGTCTGCACATTGGTTA144590.1724223667071597No Hit
AGCTACATCTGGCTACTGGGTCTC141970.16929803860167No Hit
TGTAAACATCCTTGACTGGAAGC140280.16728272772446479No Hit
TGGAGTGTGACAATGGTGTTT137050.1634309797165519No Hit
CCTCGATCCAAGTTTTTGT132100.15752814608213428No Hit
TGTAAACATCCTACACTCTCAGC131390.15668147701537943No Hit
AACATTCATTGCTGTCGGTGGGT129750.15472579072034007No Hit
TGAGGTAGTAGGTTGTGTGGTT128510.15324710108262737No Hit
CTCGATCCAAGTTTTTGT126150.1504328208044No Hit
TGAGGTAGTTGGTTGTATTGTT123760.14758276577687313No Hit
TACCCTGTAGAACCGAATTTGCG122070.1455674548996679No Hit
TGAGAACTGAATTCCATAGATGG121240.14457768683571506No Hit
AACTCCAGTCACATCACGATCTCGTAT119720.1427650995378737Illumina PCR Primer Index 1 (100% over 27bp)
GAATACCAGGTGCTGTAAGCTT119530.14253852612564355No Hit
TGGACAACTCTTAGCGG118670.14151298331239118No Hit
TACCCTGTAGATCCGGATTTGT117380.13997466909251266No Hit
CAAGCTCGTATCTATAGGTATG117280.139855419928181No Hit
GCTACGCCTGTCTGAGGGTCGCT113170.1349542792741494No Hit
TATTGCACTTGTCCCGGCCTGTA111510.13297474314624372No Hit
TCCCTGAGACCCTTAACCTGTGA110340.1315795279235632No Hit
TAACGGAACCCATAATGCAGCTG107710.12844327490164031No Hit
CTGTCTGAGGGTCGCTT107690.12841942506877396No Hit
TCCCTGAGACCCTAACTTGTGA107580.12828825098800914No Hit
TGTAACAGCAACTCCATGTGGA107130.12775162974851664No Hit
TATTGCACTTGTCCCGGCCTGTTT105180.12542627104404908No Hit
AAGTTCTGTGATACACTTTGACT105120.12535472154545008No Hit
TTCACAGTGGCTAAGTTCTGCT104870.12505659863462093No Hit
TACCCTGTAGATCCGGATTTGTG100640.12001235898339133No Hit
CTCGTACCGTGAGTAATAATGC100450.11978578557116117No Hit
TCCCTGTTCGGGCGCCA100280.11958306199179733No Hit
TCCCTGAGACCCTTAACCTGTG99340.11846211984707965No Hit
TACAGTACTGTGATAACTGAAG98790.11780624944325548No Hit
ATGACCTATGAATTGACAGC98610.11759160094745846No Hit
CAGGCTGGTTAGATGGTTGTCT96610.11520661766082507No Hit
TAGCAGCACGTAAATATTGGAG96410.11496811933216175No Hit
TCAGTGCATTACAGAACTTTGT94870.11313168220145405No Hit
AAGTTCTGTGATACACTCAGACT93040.11094942249418452No Hit
TACGACCTCAGATCAGACGAGAC91950.10964960660296932No Hit
CACGTTCCCGTGG91940.10963768168653616No Hit
TAGCTTATCAGACTGGTGTTGGCT91400.10899373619914515No Hit
GTCTGAGGGTCGCT91050.10857636412398432No Hit
ACCACGTTCCCGTGG85790.10230385808013855No Hit
TGTCTGAGGGTCGCTT85670.10216075908294053No Hit
AATTTTTGACGGTCTCTACGGGGACTG85170.10156451326128219No Hit
AACTCCAGTCACATCACGATCTCGT84650.10094441760675751Illumina PCR Primer Index 1 (100% over 25bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA300.0810.513523
CGTATGC44750.0764.327723
TAACTGC1800.0720.4563623
CAACCCG1650.0663.1473423
AATAACC1400.0549.991223
GCCCACA151.3795306E-4540.342323
GATTCCT8750.0509.4655823
ACATAGC650.0498.7774723
ATAACTA2900.0483.8055722
GCTTCCT356.491973E-9463.1504823
TCGTATG45950.0454.8509822
ACAACCC7050.0452.9243822
GGCCGCC302.0340995E-6405.2567423
TGCCCAC251.592889E-8387.044522
TCTGACT51750.0364.143723
ATCACTA203.1651798E-6362.854222
CTCATAT105.117605E-4348.9385721
AGGCTTC500.0348.9385721
GATAACA450.0348.9385421
GACAACC12150.0337.4508721