FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_5_JG25_3_CGATGT_L007_R1_001_TRIMMED_prinseq_good_lMmV.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_5_JG25_3_CGATGT_L007_R1_001_TRIMMED_prinseq_good_lMmV.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7051563
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGTCTGAGGGTCGCT5445417.722273771077419No Hit
ATGACCTATGAATTGACAGCC2787623.9531944903562515No Hit
TTCAAGTAATCCAGGATAGGCT2766513.9232578649584493No Hit
ATGACCTATGAATTGACAGCCA2625723.7236000018719255No Hit
TGAGGTAGTAGGTTGTATAGTT2614023.7070079356874492No Hit
CTACGCCTGTCTGAGGGTCGCT1786922.53407648772336No Hit
AACATTCAACGCTGTCGGTGAGT1567422.2227979811000766No Hit
AAGCTGCCAGCTGAAGAACTGT1549642.1975837130009332No Hit
TAGCTTATCAGACTGGTGTTGGC1483062.103164929534062No Hit
CTGTCTGAGGGTCGCT1435222.0353218144686505No Hit
AACATTCAACGCTGTCGGTGAG1425162.021055473800631No Hit
TGTCTGAGGGTCGCT1304531.849987017062742No Hit
TATTGCACTTGTCCCGGCCTGT1239541.7578230528465817No Hit
TGAGGTAGTAGTTTGTATAGTT986541.3990373481737313No Hit
CCACGTTCCCGTGG688590.9765069105955658No Hit
TGTAAACATCCTACACTCTCAGCT684180.9702529779568019No Hit
TGTAAACATCCTTGACTGGAAGCT675110.957390581350546No Hit
GGACAACTCTTAGCGG647660.9184630414561992No Hit
TACGCCTGTCTGAGGGTCGCT585340.8300854718308551No Hit
CTGGACAACTCTTAGCGG562780.7980925647264301No Hit
CCTGTCTGAGGGTCGCTT557280.7902928754944116No Hit
AACTCCAGTCACCGATGTATCT440270.6243580323965056Illumina PCR Primer Index 2 (100% over 22bp)
TTCACAGTGGCTAAGTTCTGC420550.596392601186432No Hit
TTCAAGTAATCCAGGATAGGTT408150.5788078472815176No Hit
AACCCGTAGATCCGAACTTGTG405290.574752008880868No Hit
TCGTACCGTGAGTAATAATGCA376410.5337965497861964No Hit
TGAGATGAAGCACTGTAGCTC355060.5035195743128155No Hit
TGGAGTGTGACAATGGTGTTTG351270.4981448793692973No Hit
ACTGGACAACTCTTAGCGG342020.4850272202063571No Hit
TGAGGTAGTAGTTTGTGCTGTT326530.4630604590783632No Hit
AACTGGACAACTCTTAGCGG315340.4471916368044928No Hit
AACTCCAGTCACCGATGTATCTC312960.4438164985550012Illumina PCR Primer Index 2 (100% over 23bp)
CATTATTACTTTTGGTACGCG300980.42682735728235No Hit
TTCACAGTGGCTAAGTTCTG296480.420445793365244No Hit
TGTAAACATCCCCGACTGGAAGCT280170.3973161694790219No Hit
GAAGGATCATTA259580.3681169692449745No Hit
TCAGTAACTGGAATCTGTCCCT245570.348249033583051No Hit
ACAGTAGTCTGCACATTGGTT240210.34064788189512024No Hit
CGCCTGTCTGAGGGTCGCT235760.33433722424375983No Hit
AACTCCAGTCACCGATGTATCTCG221480.31408639474681005Illumina PCR Primer Index 2 (100% over 24bp)
TGAGGTAGTAGGTTGTATAGTTT215950.30624416175534414No Hit
TGAGGTAGTAGATTGAATAGTT215370.3054216490726949No Hit
AACTCCAGTCACCGATGTATCTCGTATGC215060.3049820302250721Illumina PCR Primer Index 2 (100% over 29bp)
AACATTCAACGCTGTCGGTGA201510.28576643220800835No Hit
CATTGCACTTGTCTCGGTCTGA200490.28431994438679764No Hit
TCAGTAACTGGAATCTGTCCCTGC194000.2751163110930158No Hit
TGAGATGAAGCACTGTAGCTCT183560.26031108280532983No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT183260.25988564521085605No Hit
TGAGGTAGTAGGTTGTATAGT170020.24110966604141523No Hit
TTCACAGTGGTTAAGTTCTG167160.2370538276407656No Hit
CTACGCCTGTCTGAGGGTCGCTT160720.2279211006127294No Hit
TCACAGTGAACCGGTCTCTTT160270.22728294422101877No Hit
TATTGCACTTGTCCCGGCCTGTT156600.2220784243152901No Hit
TGTAAACATCCTACACTCAGCT148540.21064833427709573No Hit
TAGCTTATCAGACTGGTGTTGG146180.20730155853390234No Hit
AGCTACATCTGGCTACTGGGTCTC144730.20524527682727928No Hit
CACGTTCCCGTGG141970.2013312509581209No Hit
AACATTCATTGCTGTCGGTGGGT141500.20066473206011207No Hit
CTGTCTGAGGGTCGCTT141490.20065055080696292No Hit
AACTCCAGTCACCGATGTATCTCGTAT134050.19009969846401428Illumina PCR Primer Index 2 (100% over 27bp)
AACATTCATTGCTGTCGGTGGG132300.1876179791629175No Hit
TCGTACCGTGAGTAATAATGC130880.18560424121574182No Hit
TGTAAACATCCCCGACTGGAAGC128720.18254109053553091No Hit
TGAGGTAGTAGGTTGTGTGGTT128300.18194547790326768No Hit
TTCACAGTGGTTAAGTTCTGC126900.17996010246239025No Hit
TTCACAGTGGTTAAGTTCTGCC125440.17788963950261807No Hit
CTCGATCCAAGTTTTTGT124370.17637224541566174No Hit
AAGCTGCCAGCTGAAGAACT115370.16360911758144966No Hit
ATGACCTATGAATTGACAGCCAT112490.1595249166745018No Hit
TTCCAGTGATGACAGCCTATAATCTGACT111960.1587733102575982No Hit
TGAGGTAGTTGTTTGTACAGTT110110.15614977842501018No Hit
TACGACCTCAGATCAGACGAGAC108570.153965865440045No Hit
AAGGTCCAACCTCACATGTCCT107140.15193794623972018No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT107110.1518954024802728No Hit
TGTCTGAGGGTCGCTT107000.15173940869563243No Hit
TGTAACAGCAACTCCATGTGGA106710.15132815235430783No Hit
TGGAGTGTGACAATGGTGTTTGT106100.15046309591221124No Hit
TTCAAGTAATCCAGGATAGGC105230.1492293268882374No Hit
TGTAAACATCCTTGACTGGAAGC104600.14833590793984255No Hit
CCTCGATCCAAGTTTTTGT104520.14822245791464955No Hit
GTCTGAGGGTCGCT104470.14815155164890392No Hit
TGTAAACATCCTACACTCTCAGC103440.1466908825745441No Hit
ACCACGTTCCCGTGG100320.14226633159201726No Hit
CACCACGTTCCCGTGG96160.13636693028198146No Hit
TGGACAACTCTTAGCGG96050.1362109364973411No Hit
TTGGTCCCCTTCAACCAGCTGT95400.135289155042648No Hit
TTCAAGTAATCCAGGATAGGCTT95190.13499134872651636No Hit
GCTACGCCTGTCTGAGGGTCGCT95140.13492044246077076No Hit
TACGACCTCAGATCAGACGAGA92610.13133258541404225No Hit
TGAGGTAGTAAGTTGTGTTGTT92400.13103477909791064No Hit
AACTCCAGTCACCGATGTATCTCGT91000.12904940365703318Illumina PCR Primer Index 2 (100% over 25bp)
TCAGTAACTGGAATCTGTCCCTG89540.126978940697261No Hit
CTCGTACCGTGAGTAATAATGC89130.12639750931814692No Hit
CAGGCTGGTTAGATGGTTGTCT89050.12628405929295392No Hit
ACAGTAGTCTGCACATTGGTTA88560.12558917788864682No Hit
TTCACAGTGGCTAAGTTCTGCT87250.1237314337261115No Hit
TGAGGTAGTTAGTTGTGTTGTT85880.12178860204468145No Hit
AAACCGTTACCATTACTGAGTTT85590.12137734570335683No Hit
TGAGGTAGTTGGTTGTATAGTT84490.11981740785695313No Hit
GGAATACCAGGTGCTGTAAGCTT84150.1193352452498829No Hit
TCCCTGAGACCCTAACTTGTGA83470.11837092003574243No Hit
AATTTTTGACGGTCTCTACGGGGACTG82930.1176051323656897No Hit
TAGCAGCACGTAAATATTGGAG82090.11641390710116324No Hit
TACGACCTCAGATCAGACGAGACAACC81970.11624373206337375No Hit
TTTTGCAGAAACGTTTCAGATT81900.11614446329132988No Hit
TACCCTGTAGAACCGAATTTGCG81040.11492487552050518No Hit
TATTGCACTTGTCCCGGCCTGTA80900.11472633797641743No Hit
TCCAGTGATGACAGCCTATAATCTGACT79850.11323730639575935No Hit
TACGACCTCAGATCAGA79010.11204608113123289No Hit
ACGCCTGTCTGAGGGTCGCT77040.10925237426085536No Hit
CACTCCAGTCACCGATGTATCT75940.10769243641445166Illumina PCR Primer Index 2 (95% over 22bp)
AAGTTCTGTGATACACTTTGACT75720.10738044884517092No Hit
TAACGGAACCCATAATGCAGCTG74860.10616086107434622No Hit
TGGAGTGTGACAATGGTGTTT74570.10574960473302158No Hit
TACGCCTGTCTGAGGGTCGCTT72910.10339551671026692No Hit
TACGACCTCAGATCAGACGAGACAACCC72540.10287081034374933No Hit
TGAGATGAAGCACTGTAGCT71830.10186394137016148No Hit
ATGACCTATGAATTGACAGC70860.1004883598146964No Hit
AACTCTTAGCGG70730.10030400352375778No Hit
AAGCTGCCAGCTGAAGAACTGC70680.10023309725801216No Hit
CAAGCTCGTATCTATAGGTATG70650.10019055349856477No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA550.0698.2881523
CAACCCG4300.0633.331123
TAACTGC2750.0622.1112723
CGTATGC26400.0618.9372623
GATTCCT22150.0578.491623
AATAACC1150.0576.8467423
CATAGCT2300.0470.585523
ATAACTA3850.0408.476222
ACAACCC12700.0392.3944722
TCGTATG27250.0359.0093422
TTCTGGC750.0354.0127322
GGATTCC26350.0328.6411722
TAATAAC1900.0322.4812322
GCATAGC4750.0322.481222
GACCACC356.8252575E-6299.2663623
AGCATGC356.8252575E-6299.2663623
GCAGGGA356.8252575E-6299.2663623
AGGCTTC109.6223224E-4282.618121
ACACAGC259.961217E-4279.3152823
CGTAGGC259.961217E-4279.3152823