FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_5_JG35_3_TTAGGC_L006_R1_001_TRIMMED_prinseq_good_GdIJ.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_5_JG35_3_TTAGGC_L006_R1_001_TRIMMED_prinseq_good_GdIJ.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6206133
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC3805616.132014895587961No Hit
ATGACCTATGAATTGACAGCCA3418435.508148149580423No Hit
TTCAAGTAATCCAGGATAGGCT3051554.916990982951864No Hit
CCTGTCTGAGGGTCGCT3033524.887939075749746No Hit
TGAGGTAGTAGGTTGTATAGTT2296503.700371874080043No Hit
AAGCTGCCAGCTGAAGAACTGT1428152.301191418230966No Hit
TAGCTTATCAGACTGGTGTTGGC1262422.0341491231335196No Hit
AACATTCAACGCTGTCGGTGAG1126261.8147532448950092No Hit
CTACGCCTGTCTGAGGGTCGCT1061241.7099859123225365No Hit
TGTAAACATCCTTGACTGGAAGCT942141.5180789712370004No Hit
AACATTCAACGCTGTCGGTGAGT913761.4723500124795907No Hit
AACTCCAGTCACTTAGGCATCTCGTATGC890671.4351448800726636Illumina PCR Primer Index 3 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGT782221.260398383341124No Hit
TGAGGTAGTAGTTTGTATAGTT756831.2194872394774654No Hit
CTGTCTGAGGGTCGCT721521.1625919070699902No Hit
TGTCTGAGGGTCGCT678041.092532177444473No Hit
TGTAAACATCCTACACTCTCAGCT630761.0163494723687037No Hit
TGAGATGAAGCACTGTAGCTC492290.7932314695801718No Hit
TCAGTAACTGGAATCTGTCCCT481930.7765383049315894No Hit
TTCAAGTAATCCAGGATAGGTT465460.7500000402827331No Hit
TGGAGTGTGACAATGGTGTTTG427390.6886574941271804No Hit
TTCACAGTGGCTAAGTTCTGC413590.6664214253867907No Hit
TGAGATGAAGCACTGTAGCTCT409960.6605723725224709No Hit
TCGTACCGTGAGTAATAATGCA366940.5912538451883No Hit
AACTCCAGTCACTTAGGCATCT364110.5866938397871911Illumina PCR Primer Index 3 (100% over 22bp)
TACGCCTGTCTGAGGGTCGCT362150.5835356735023243No Hit
TTCACAGTGGCTAAGTTCTG351410.5662302113087168No Hit
GGACAACTCTTAGCGG329970.5316837392946622No Hit
CATTATTACTTTTGGTACGCG326320.5258024602437621No Hit
AACCCGTAGATCCGAACTTGTG315690.508674242076346No Hit
CTGGACAACTCTTAGCGG308420.49696002325441624No Hit
CCACGTTCCCGTGG301850.48637372096279596No Hit
TGAGGTAGTAGGTTGTATAGTTT262630.4231781690788773No Hit
TGTAAACATCCCCGACTGGAAGCT251780.40569546285907826No Hit
TCAGTAACTGGAATCTGTCCCTGC249000.40121602292442005No Hit
ACAGTAGTCTGCACATTGGTT239750.38631141163104304No Hit
TTCCAGTGATGACAGCCTATAATCTGACT239110.38528017366047423No Hit
TTCACAGTGGTTAAGTTCTG238960.38503847726112217No Hit
AACTCCAGTCACTTAGGCATCTC236530.3811229955916188Illumina PCR Primer Index 3 (100% over 23bp)
CCTGTCTGAGGGTCGCTT235650.3797050433820867No Hit
AACTCCAGTCACTTAGGCATCTCG221210.3564377366711284Illumina PCR Primer Index 3 (100% over 24bp)
ATGACCTATGAATTGACAGCCAT216180.34833285074618925No Hit
TGAGGTAGTAGTTTGTGCTGTT204820.33002837676859326No Hit
ACTGGACAACTCTTAGCGG200960.32380872275860023No Hit
TGTAAACATCCTACACTCAGCT196180.3161066641659146No Hit
TCGTACCGTGAGTAATAATGC195790.31547825352759923No Hit
TGAGGTAGTAGATTGAATAGTT192270.3098064446894709No Hit
TCCAGTGATGACAGCCTATAATCTGACT169200.272633538469124No Hit
AACTGGACAACTCTTAGCGG168010.27071608036759764No Hit
TGTAAACATCCTTGACTGGAAGC167030.2691369972251642No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT166160.26773515810892223No Hit
TGAGGTAGTAGGTTGTATAGT165820.2671873129370576No Hit
CATTGCACTTGTCTCGGTCTGA158980.2561659571266036No Hit
TAGCTTATCAGACTGGTGTTGG155270.2501879995159627No Hit
TCAGTAACTGGAATCTGTCCCTG153400.24717485107070702No Hit
TGGAGTGTGACAATGGTGTTTGT151700.24443562521138362No Hit
TGAGATGAAGCACTGTAGCT149830.24142247676612796No Hit
TTTTGCAGAAACGTTTCAGATT147360.23744254272346405No Hit
GAAGGATCATTA145250.23404268003924503No Hit
AACTCCAGTCACTTAGGCATCTCGTAT143290.23088451375437813Illumina PCR Primer Index 3 (100% over 27bp)
TGTAAACATCCCCGACTGGAAGC142770.230046632903291No Hit
TTCACAGTGGTTAAGTTCTGC137550.2216355982058393No Hit
CGCCTGTCTGAGGGTCGCT132510.21351459918761007No Hit
AACATTCAACGCTGTCGGTGA128730.20742384992393814No Hit
AAGCTGCCAGCTGAAGAACT127720.2057964275016343No Hit
TTCAAGTAATCCAGGATAGGCTT126650.20407232651958956No Hit
TTCAAGTAATCCAGGATAGGC125530.2022676600710942No Hit
TTCACAGTGGTTAAGTTCTGCC123270.19862610098752312No Hit
TATTGCACTTGTCCCGGCCTGTT122710.19772376776327547No Hit
TGTAAACATCCTACACTCTCAGC121040.19503288118382253No Hit
ATGACCTATGAATTGACAGC112480.18124007332746495No Hit
TCACAGTGAACCGGTCTCTTT109920.1771151214451898No Hit
TACCCTGTAGAACCGAATTTGCG105460.1699286818377885No Hit
CTCGTACCGTGAGTAATAATGC100830.16246831964445493No Hit
AAGTTCTGTGATACACTCAGACT98920.1593907188260387No Hit
ACAGTAGTCTGCACATTGGTTA98740.15910068314681622No Hit
TGGAGTGTGACAATGGTGTTT95260.15349332668184842No Hit
TGGACAACTCTTAGCGG95160.15333219574894705No Hit
TGTAACAGCAACTCCATGTGGA94900.1529132553234035No Hit
TAACGGAACCCATAATGCAGCTG93770.15109247578161797No Hit
TGAGGTAGTAAGTTGTGTTGTT93640.15088300556884618No Hit
TGAGGTAGTAGGTTGTGTGGTT93490.15064130916949411No Hit
TTCACAGTGGCTAAGTTCTGCT92500.1490461129337705No Hit
TCCCTGAGACCCTAACTTGTGA91720.1477892916571398No Hit
GTACAGTACTATGATAACTGAA88140.14202080425927063No Hit
ATGACCTATGAATTGACAGCCT87270.14061896514302868No Hit
AACATTCATTGCTGTCGGTGGG87090.1403289294638062No Hit
TGAGGTAGTTGTTTGTACAGTT86670.13965217954562043No Hit
TTGGTCCCCTTCAACCAGCTGT85340.13750913813803217No Hit
AATTTTTGACGGTCTCTACGGGGACTG85020.13699351915274777No Hit
AACTCCAGTCACTTAGGCATCTCGT83670.1348182515585792Illumina PCR Primer Index 3 (100% over 25bp)
TACAGTACTGTGATAACTGAAG83520.13457655515922717No Hit
AAGGTCCAACCTCACATGTCCT78980.12726121080550482No Hit
TAGCTTATCAGACTGGTGTTGGCT78170.1259560502490037No Hit
TGAGGTAGTTGGTTGTATAGTT76810.123764669561545No Hit
AAACCGTTACCATTACTGAGTTT76320.12297512799032827No Hit
TATTGCACTTGTCCCGGCCTGTA74020.11926911653359668No Hit
TGAGAACTGAATTCCATAGATGG73920.11910798560069531No Hit
CTACGCCTGTCTGAGGGTCGCTT73700.1187534975483123No Hit
TCAGTGCATTACAGAACTTTGT72960.11756112864484212No Hit
AACATTCATTGCTGTCGGTGGGT71970.11596593240911852No Hit
CCTCGATCCAAGTTTTTGT71920.11588536694266784No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT71520.11524084321106234No Hit
CTCGATCCAAGTTTTTGT69830.11251773044502913No Hit
TGAGGTAGTTAGTTGTGTTGTT68780.11082585564956471No Hit
TACCCTGTAGATCCGGATTTGT67370.10855390949565534No Hit
AGCTACATCTGGCTACTGGGTCTC66090.10649143355451778No Hit
TATTGCACTTGTCCCGGCCTGTTT66070.1064592073679375No Hit
AAGTTCTGTGATACACTTTGACT65780.1059919276625235No Hit
ATTTTTGACGGTCTCTACGGGGACTG64560.10402613028112676No Hit
TACGACCTCAGATCAGACGAGA64230.10349439820255221No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGTACCA102.7645178E-4428.5258523
TAACTAC102.7645178E-4428.5258523
TAACTAA450.0428.5258523
CGTATGC97600.0414.256323
TAACTGC2750.0405.1517323
CAACCCG3050.0379.3507723
AATAACC1850.0370.6169723
GCTTCCT1250.0359.9617323
GATTCCT23950.0322.9599623
AGCATGC159.313949E-4285.683923
GGATACC109.33459E-4285.4938722
ATAACTA4700.0285.4938722
CGGTACC109.33459E-4285.4938722
CGCCCCA109.33459E-4285.4938722
CATAGCT1900.0281.924923
TCGTATG99150.0274.8400322
ACAACCC9050.0269.7207322
ACATAGC251.2518514E-5257.115523
TGGTCTC251.2518514E-5257.115523
TAATAAC2700.0248.485422