FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_7_JG48_3_GCCAAT_L008_R1_001_TRIMMED_prinseq_good_T2bG.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_7_JG48_3_GCCAAT_L008_R1_001_TRIMMED_prinseq_good_T2bG.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7153097
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCA4483556.267984343005555No Hit
ATGACCTATGAATTGACAGCC4387176.1332455019133665No Hit
TTCAAGTAATCCAGGATAGGCT3689475.157863789628465No Hit
CCTGTCTGAGGGTCGCT3343524.6742271214831845No Hit
AACTCCAGTCACGCCAATATCTCGTATGC2594383.6269325021036343Illumina PCR Primer Index 6 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGT2136652.987027856605328No Hit
TGAGGTAGTAGGTTGTATAGTT1854802.593002723156138No Hit
AACATTCAACGCTGTCGGTGAG1203131.681970760357367No Hit
TATTGCACTTGTCCCGGCCTGT1150571.6084920978982948No Hit
AACATTCAACGCTGTCGGTGAGT1110761.5528378826681646No Hit
TAGCTTATCAGACTGGTGTTGGC1079121.5086052936231675No Hit
TCAGTAACTGGAATCTGTCCCT1078191.5073051574723506No Hit
CTACGCCTGTCTGAGGGTCGCT910821.2733225902011396No Hit
CTGTCTGAGGGTCGCT764241.068404356882061No Hit
TGAGGTAGTAGTTTGTATAGTT762711.0662654232145878No Hit
TGTAAACATCCTTGACTGGAAGCT678100.9479809934074709No Hit
TGTCTGAGGGTCGCT612410.856146645292242No Hit
TGGAGTGTGACAATGGTGTTTG576090.8053714356173277No Hit
TGTAAACATCCTACACTCTCAGCT511060.7144597647704204No Hit
GGACAACTCTTAGCGG481910.6737081854195462No Hit
TGAGATGAAGCACTGTAGCTC478340.6687173401954427No Hit
CTGGACAACTCTTAGCGG466520.652193029117318No Hit
TTCAAGTAATCCAGGATAGGTT465510.6507810532976136No Hit
TCAGTAACTGGAATCTGTCCCTGC411830.575736635474117No Hit
ACAGTAGTCTGCACATTGGTT374870.524066708448103No Hit
AACCCGTAGATCCGAACTTGTG369040.5159163925779281No Hit
TGAGATGAAGCACTGTAGCTCT323120.45172042263651674No Hit
TGAGGTAGTAGATTGAATAGTT313370.43808996299085556No Hit
TACGCCTGTCTGAGGGTCGCT296320.4142541335592122No Hit
ACTGGACAACTCTTAGCGG292840.4093891079626069No Hit
CCACGTTCCCGTGG291200.4070963947504137No Hit
AACTCCAGTCACGCCAATATCT285020.3984567803288561Illumina PCR Primer Index 6 (100% over 22bp)
TCAGTAACTGGAATCTGTCCCTG277610.38809763099815364No Hit
CCTGTCTGAGGGTCGCTT262830.36743525217119244No Hit
AACATTCAACGCTGTCGGTGA260950.3648070199523367No Hit
TTCACAGTGGCTAAGTTCTGC260270.36385638276679316No Hit
TTCACAGTGGCTAAGTTCTG256850.35907523692185356No Hit
TGTAAACATCCCCGACTGGAAGCT254070.35518880842801376No Hit
AACTGGACAACTCTTAGCGG250360.35000224378335704No Hit
TGAGGTAGTAGTTTGTGCTGTT248920.3479891297433825No Hit
TTCCAGTGATGACAGCCTATAATCTGACT245540.3432639037328866No Hit
CATTGCACTTGTCTCGGTCTGA235390.32907424574278804No Hit
ATGACCTATGAATTGACAGCCAT217030.3034070417331123No Hit
TTCACAGTGGTTAAGTTCTG209450.2928102331060239No Hit
CATTATTACTTTTGGTACGCG202020.28242312385809953No Hit
TATTGCACTTGTCCCGGCCTGTT201440.2816122862586653No Hit
TCGTACCGTGAGTAATAATGCA196330.27446852740847777No Hit
TCCAGTGATGACAGCCTATAATCTGACT183460.256476320676205No Hit
TGAGGTAGTAGGTTGTATAGTTT177870.2486615238126926No Hit
AAACCGTTACCATTACTGAGTTT177670.2483819246404739No Hit
TGTAAACATCCTACACTCAGCT176840.24722158807576633No Hit
TCACAGTGAACCGGTCTCTTT171210.23935087137781022No Hit
TGAGGTAGTAGGTTGTATAGT170940.23897341249531495No Hit
TTCAAGTAATCCAGGATAGGC170740.23869381332309625No Hit
TAGCTTATCAGACTGGTGTTGG168620.23573006209757819No Hit
TGGAGTGTGACAATGGTGTTTGT162230.22679686854519102No Hit
TTTTGCAGAAACGTTTCAGATT158390.22142856443859213No Hit
AACTCCAGTCACGCCAATATCTC157860.22068762663221259Illumina PCR Primer Index 6 (100% over 23bp)
TTCAAGTAATCCAGGATAGGCTT155590.21751417602753048No Hit
ATGACCTATGAATTGACAGC146860.2053096721601846No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC146770.20518385253268617No Hit
AAGGTCCAACCTCACATGTCCT142940.19982952838469825No Hit
TGTAAACATCCCCGACTGGAAGC141190.19738303562778473No Hit
TGGAGTGTGACAATGGTGTTT140550.19648831827668492No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT139770.195397881505032No Hit
AAGCTGCCAGCTGAAGAACT135290.18913486004733335No Hit
GCATGAGTGACTGGTTAATCTTT133380.18646468795264484No Hit
ACAGTAGTCTGCACATTGGTTA130450.18236856007964103No Hit
TGTAACAGCAACTCCATGTGGA130200.18201906111436766No Hit
AGCTACATCTGGCTACTGGGTCTC129780.1814319028527084No Hit
AACATTCATTGCTGTCGGTGGG129270.18071892496355074No Hit
CACCACGTTCCCGTGG127640.17844019170996844No Hit
TGAGGTAGTTGTTTGTACAGTT125930.1760496187874986No Hit
TATTGCACTTGTCCCGGCCTGTA125620.17561624007055965No Hit
GAGAGAGGCATGATCGTAGCGATA121160.16938117853008283No Hit
TGTAAACATCCTTGACTGGAAGC119560.16714438515233332No Hit
TGAGATGAAGCACTGTAGCT116670.16310417711377323No Hit
CGCCTGTCTGAGGGTCGCT114210.15966510729548336No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG113660.15889620957188194No Hit
AACATTCATTGCTGTCGGTGGGT111970.15653359656663401No Hit
TTCACAGTGGTTAAGTTCTGC107700.15056415423976496No Hit
TACCCTGTAGAACCGAATTTGCG107020.1496135170542214No Hit
TGGACAACTCTTAGCGG104200.14567116872593786No Hit
AACTCCAGTCACGCCAATATCTCG103480.14466461170595057Illumina PCR Primer Index 6 (100% over 24bp)
TATTGCACTTGTCCCGGCCTGTTT102790.1436999945617961No Hit
TCGTACCGTGAGTAATAATGC99100.13854138983436126No Hit
AAGTTCTGTGATACACTCAGACT97370.13612285699466958No Hit
TACAGTACTGTGATAACTGAAG96510.1349205805541292No Hit
TATTGCACTTGTCCCGGCCTGTAT96450.13483670080246363No Hit
GAAGGATCATTA95580.13362044440331228No Hit
TCAGTGCATTACAGAACTTTGT94580.13222244854221885No Hit
ATGACCTATGAATTGACAGCCT90960.12716170352506054No Hit
TGAGGTAGTAAGTTGTGTTGTT90820.12696598410450746No Hit
CACGTTCCCGTGG88720.12403019279621122No Hit
AAGTTCTGTGATACACTTTGACT86820.12137400066013365No Hit
GAGAGAGGCATGATCGTAGCG84760.11849412918628113No Hit
GAGAGAGGCATGATCGTAGC84520.1181586101796187No Hit
TACCCTGTAGATCCGGATTTGT83810.11716603311824235No Hit
TTCACAGTGGTTAAGTTCTGCC82840.11580997713298169No Hit
TGTAAACATCCTACACTCTCAGC81350.11372696329995245No Hit
TGTAAACATCCCCGACTGGA80850.11302796536940574No Hit
TCCCTGAGACCCTAACTTGTGA79880.11167190938414509No Hit
AGTAGAGTCAGCT78260.10940715608917367No Hit
GAGAGAGGCATGATCGTAGCGAT77540.10840059906918639No Hit
GGCCGTGATCGTATAGTGGTTAGTACTCT77400.10820487964863332No Hit
ACCACGTTCCCGTGG77360.10814895981418958No Hit
CAGGCTGGTTAGATGGTTGTCT76170.10648534473948837No Hit
GTACAGTACTATGATAACTGAA74670.10438835094784818No Hit
CAAGCTCGTATCTATAGGTATG74450.10408079185840761No Hit
CCTCGATCCAAGTTTTTGT73500.10275269579036884No Hit
TAGCAGCACGTAAATATTGGAG72080.10076754166761615No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAC100.0012714593257.5092223
CGTATGC273350.0251.009123
GATTCCT17300.0221.0411523
CAACCCG2450.0220.7222123
TAACTAA700.0220.722223
TAACTGC3250.0217.8924323
CCCGTTC1100.0198.9844223
GCCCACA203.9227052E-5193.1319323
TATTCCG203.9227052E-5193.1319323
TCACCTT100.003043997192.3709122
GGATACG100.003043997192.3709122
AGGCAAT100.003043997192.3709122
TCATATG100.003043997192.3709122
GCGTATG100.003043997192.3709122
TAGTCGG256.852133E-9192.3709122
TAGTATG153.985639E-5192.3709122
ATAACTA6650.0188.0317122
GCTTCCT1650.0187.2794323
TCGTATG277050.0185.7398422
AATAACC1600.0185.0847623