FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_7_JG53_3_CAGATC_L007_R1_001_TRIMMED_prinseq_good_9kk9.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_7_JG53_3_CAGATC_L007_R1_001_TRIMMED_prinseq_good_9kk9.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6327722
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGTCTGAGGGTCGCT3652385.772029807883469No Hit
ATGACCTATGAATTGACAGCCA3215485.08157596051154No Hit
ATGACCTATGAATTGACAGCC2901834.585899949460486No Hit
TTCAAGTAATCCAGGATAGGCT2586394.087395116283553No Hit
TGAGGTAGTAGGTTGTATAGTT1659882.6231873018441707No Hit
AAGCTGCCAGCTGAAGAACTGT1559222.4641095168213774No Hit
AACATTCAACGCTGTCGGTGAGT1195381.8891158619168162No Hit
CTACGCCTGTCTGAGGGTCGCT1179281.863672266259485No Hit
AACATTCAACGCTGTCGGTGAG1169801.8486905714252302No Hit
TAGCTTATCAGACTGGTGTTGGC963351.5224278184155373No Hit
TATTGCACTTGTCCCGGCCTGT893741.4124198250175972No Hit
CTGTCTGAGGGTCGCT882611.3948305567153552No Hit
TGTCTGAGGGTCGCT752551.1892905535356957No Hit
TGAGGTAGTAGTTTGTATAGTT678611.0724396552187343No Hit
TCAGTAACTGGAATCTGTCCCT647771.0237017365807157No Hit
TGTAAACATCCTTGACTGGAAGCT580990.9181661267672632No Hit
TGGAGTGTGACAATGGTGTTTG488700.7723158507911694No Hit
TGAGATGAAGCACTGTAGCTC417820.6603008159966572No Hit
GGACAACTCTTAGCGG405090.6401829916042456No Hit
CTGGACAACTCTTAGCGG386460.6107411166293336No Hit
CCACGTTCCCGTGG377970.5973239658758712No Hit
TGTAAACATCCTACACTCTCAGCT364820.5765423955097901No Hit
AACTCCAGTCACCAGATCATCT357340.5647213957882474Illumina PCR Primer Index 7 (100% over 22bp)
TCAGTAACTGGAATCTGTCCCTGC351070.5548126166098952No Hit
TACGCCTGTCTGAGGGTCGCT348190.55026121564759No Hit
TTCAAGTAATCCAGGATAGGTT324210.5123644812461736No Hit
AACCCGTAGATCCGAACTTGTG290900.4597231041439558No Hit
CCTGTCTGAGGGTCGCTT283790.4484868330182647No Hit
ACAGTAGTCTGCACATTGGTT259930.4107797403236109No Hit
ACTGGACAACTCTTAGCGG252670.3993064170644665No Hit
TGAGATGAAGCACTGTAGCTCT241140.381085009739682No Hit
AACATTCAACGCTGTCGGTGA238490.3768970887153386No Hit
TGTAAACATCCCCGACTGGAAGCT231980.3666090261234612No Hit
TGAGGTAGTAGTTTGTGCTGTT225420.3562419461537659No Hit
TGAGGTAGTAGATTGAATAGTT222680.3519117938493505No Hit
AACTGGACAACTCTTAGCGG215430.34045427406576967No Hit
AACTCCAGTCACCAGATCATCTC203350.32136367558498935Illumina PCR Primer Index 7 (100% over 23bp)
TTCACAGTGGCTAAGTTCTGC189170.29895434723586145No Hit
AACTCCAGTCACCAGATCATCTCGTATGC177090.27986374875508124Illumina PCR Primer Index 7 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTG175950.2780621525408354No Hit
TTCCAGTGATGACAGCCTATAATCTGACT172750.2730050403604962No Hit
CATTATTACTTTTGGTACGCG172540.2726731673736615No Hit
TTCACAGTGGCTAAGTTCTG171030.27028684256356394No Hit
CATTGCACTTGTCTCGGTCTGA168120.265688031174568No Hit
GCATGAGTGACTGGTTAATCTTT164020.2592086061935085No Hit
ATGACCTATGAATTGACAGCCAT156670.24759305165429202No Hit
TCGTACCGTGAGTAATAATGCA155930.24642359446258857No Hit
TTCACAGTGGTTAAGTTCTG153930.24326289934987663No Hit
TGAGGTAGTAGGTTGTATAGTTT139800.22093258837856655No Hit
CGCCTGTCTGAGGGTCGCT136270.21535396150462993No Hit
TATTGCACTTGTCCCGGCCTGTT135510.2141528973617994No Hit
TCACAGTGAACCGGTCTCTTT132900.21002819023971026No Hit
AACTCCAGTCACCAGATCATCTCG131190.20732579591834158Illumina PCR Primer Index 7 (100% over 24bp)
TGAGGTAGTAGGTTGTATAGT128670.2033433200763245No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC127420.20136788563087948No Hit
TGAGGTAGTTGTTTGTACAGTT126400.19975593112339637No Hit
TGGAGTGTGACAATGGTGTTTGT126400.19975593112339637No Hit
TTTTGCAGAAACGTTTCAGATT120030.18968911718940876No Hit
TCCAGTGATGACAGCCTATAATCTGACT115620.18271978446587886No Hit
AACATTCATTGCTGTCGGTGGG114230.18052310136254407No Hit
CACGTTCCCGTGG113390.17919560941520501No Hit
GAAGGATCATTA113160.17883212947724317No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT110740.17500768839086167No Hit
TGAGATGAAGCACTGTAGCT110250.17423331808824724No Hit
TGTAAACATCCCCGACTGGAAGC109840.17358537559014128No Hit
TTCAAGTAATCCAGGATAGGC109640.1732693060788701No Hit
AACATTCATTGCTGTCGGTGGGT107600.17004539706390387No Hit
AGCTACATCTGGCTACTGGGTCTC107550.16996637968608608No Hit
TAGCTTATCAGACTGGTGTTGG105410.16658443591548427No Hit
TGGAGTGTGACAATGGTGTTT104210.16468801884785708No Hit
TGTAACAGCAACTCCATGTGGA103930.16424552153207742No Hit
TTCAAGTAATCCAGGATAGGCTT101790.1608635777614756No Hit
TGTAAACATCCTACACTCAGCT100710.15915680240061117No Hit
AAGCTGCCAGCTGAAGAACT99880.15784511392883568No Hit
ATGACCTATGAATTGACAGC97210.1536255859533652No Hit
TCCCTGTTCGGGCGCCA96270.15214005925039056No Hit
ACAGTAGTCTGCACATTGGTTA95350.1506861394985431No Hit
AAGTTCTGTGATACACTCAGACT94760.14975373444029305No Hit
TGAGGTAGTAAGTTGTGTTGTT94500.1493428440756405No Hit
CCTCGATCCAAGTTTTTGT92580.146308576767437No Hit
TGGACAACTCTTAGCGG87620.1384700528879113No Hit
TGTAAACATCCTTGACTGGAAGC87090.13763246868304266No Hit
CTACGCCTGTCTGAGGGTCGCTT86590.13684229490486466No Hit
TTCACAGTGGTTAAGTTCTGC86150.13614694198006802No Hit
GGGGCTATAGCTCAGTGGTAGAGCATTC84740.1339186519256061No Hit
AACTCCAGTCACCAGATCATCTCGTAT84260.1331600850985552Illumina PCR Primer Index 7 (100% over 27bp)
GAAAGTCAGCCCTCGATCCAAGTTTTTGT83520.1319906279068518No Hit
TACCCTGTAGAACCGAATTTGCG80290.12688610529982194No Hit
TATTGCACTTGTCCCGGCCTGTA77150.12192381397286417No Hit
GAGAGAGGCATGATCGTAGCGATA76260.12051730464770734No Hit
ACCACGTTCCCGTGG75870.1199009691007285No Hit
AAGTTCTGTGATACACTTTGACT75470.11926883007818612No Hit
CTCGATCCAAGTTTTTGT73250.11576045850307583No Hit
AACATTCATTGCTGTCGGTGGGTT73050.11544438899180463No Hit
CAAGCTCGTATCTATAGGTATG72780.11501769515158851No Hit
TGAGGTAGTTGGTTGTATAGTT71510.11301065375501641No Hit
CACCACGTTCCCGTGG70690.11171476875880451No Hit
TATTGCACTTGTCCCGGCCTGTTT68250.1078587207212959No Hit
TGAGGTAGTTAGTTGTGTTGTT68190.10776389986791456No Hit
CTGTCTGAGGGTCGCTT67270.10630998011606704No Hit
AAACCGTTACCATTACTGAGTTT66710.10542498548450771No Hit
TCAGTGCATTACAGAACTTTGT66290.10476123951083818No Hit
CAGGCTGGTTAGATGGTTGTCT66260.1047138290841475No Hit
TACCCTGTAGATCCGGATTTGT64870.10251714598081267No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG64290.10160054439812621No Hit
TTCACAGTGGTTAAGTTCTGCC64060.10123706446016434No Hit
CACTCCAGTCACCAGATCATCT63810.10084197757107534Illumina PCR Primer Index 7 (95% over 22bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GACGTTC3350.0423.1595823
CAACCCG4200.0411.352723
TAACTGC2250.0393.773523
CACTTCA850.0390.8781423
TAACTAA400.0387.620823
GCATTCG750.0383.9291723
CACTTCC350.0379.710223
GATTCCT14350.0378.1666323
ATACATT1600.0373.777223
GATATCC252.4718247E-8354.3961823
GCTTCCT450.0344.5518223
CGCGCTG204.499072E-6332.246423
ATCCGCC204.499072E-6332.246423
ATGCCGT7900.0325.2369723
GATATCT4600.0322.616123
TATCTCC8600.0311.6419723
CGTATGC25850.0307.6117623
CGCACTG4350.0290.2382223
AATAACC950.0279.7864423
CACACTC1750.0265.797123