FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_7_JG55_3_ACTTGA_L006_R1_001_TRIMMED_prinseq_good_tOgI.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_7_JG55_3_ACTTGA_L006_R1_001_TRIMMED_prinseq_good_tOgI.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5783205
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT2745634.747592381732966No Hit
CCTGTCTGAGGGTCGCT2713584.692173284536862No Hit
ATGACCTATGAATTGACAGCC2532354.378800336491617No Hit
ATGACCTATGAATTGACAGCCA2362244.0846554808276725No Hit
TAGCTTATCAGACTGGTGTTGGC2128503.6804851289207283No Hit
TGAGGTAGTAGGTTGTATAGTT1421302.4576337861099513No Hit
AAGCTGCCAGCTGAAGAACTGT1278962.211507287049309No Hit
CTACGCCTGTCTGAGGGTCGCT964401.6675874363782712No Hit
AACATTCAACGCTGTCGGTGAG813331.4063655014823095No Hit
TGTAAACATCCTTGACTGGAAGCT810941.4022328449363286No Hit
AACATTCAACGCTGTCGGTGAGT784131.3558744675314123No Hit
TGAGGTAGTAGTTTGTATAGTT705761.2203613740131987No Hit
TATTGCACTTGTCCCGGCCTGT688461.1904471655422901No Hit
CTGTCTGAGGGTCGCT632491.0936669199864089No Hit
TGTCTGAGGGTCGCT563190.9738371716029433No Hit
TAACGGAACCCATAATGCAGCTG542700.9384069905873992No Hit
TGTAAACATCCTACACTCTCAGCT475320.821897200600705No Hit
TGAGATGAAGCACTGTAGCTC404330.6991451971700813No Hit
GGACAACTCTTAGCGG376160.6504351825674518No Hit
TTCAAGTAATCCAGGATAGGTT372130.6434667282242286No Hit
CTGGACAACTCTTAGCGG356450.616353734650596No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT354860.6136043941032697No Hit
TGGAGTGTGACAATGGTGTTTG342160.5916442526246259No Hit
AACTCCAGTCACACTTGAATCT330430.571361381794351Illumina PCR Primer Index 8 (100% over 22bp)
AACCCGTAGATCCGAACTTGTG326310.5642373044012793No Hit
TGAGATGAAGCACTGTAGCTCT307710.5320752074325569No Hit
TACGCCTGTCTGAGGGTCGCT291480.5040111841098491No Hit
TTCACAGTGGCTAAGTTCTGC271880.4701199421428084No Hit
CCACGTTCCCGTGG257620.4454623344667879No Hit
AACTCCAGTCACACTTGAATCTC240120.41520229699621575Illumina PCR Primer Index 8 (100% over 23bp)
AACTCCAGTCACACTTGAATCTCGTATGC235790.407715099153497Illumina PCR Primer Index 8 (100% over 29bp)
TTCACAGTGGTTAAGTTCTG235490.40719635565400153No Hit
ACTGGACAACTCTTAGCGG233190.4032193221578692No Hit
TGTAAACATCCCCGACTGGAAGCT230860.39919041431178737No Hit
TTCACAGTGGCTAAGTTCTG223600.38663682162399565No Hit
TGAGGTAGTAGATTGAATAGTT218200.3772994386330763No Hit
AACTGGACAACTCTTAGCGG216420.37422156053606953No Hit
ACAGTAGTCTGCACATTGGTT211870.3663539507937208No Hit
TCGTACCGTGAGTAATAATGCA202710.35051498260912417No Hit
TGAGAACTGAATTCCATAGATGG197740.3419211319674817No Hit
TTCCAGTGATGACAGCCTATAATCTGACT196650.34003636391931463No Hit
TGAGGTAGTAGTTTGTGCTGTT196030.3389642940203572No Hit
CCTGTCTGAGGGTCGCTT189070.3269294448320611No Hit
CATTATTACTTTTGGTACGCG185830.32132701503750943No Hit
TCAGTAACTGGAATCTGTCCCT183530.31734998154137717No Hit
TAGCTTATCAGACTGGTGTTGG162350.28072669047699333No Hit
TTCACAGTGGTTAAGTTCTGC161990.2801041982775987No Hit
AACTCCAGTCACACTTGAATCTCG149940.2592680010478619Illumina PCR Primer Index 8 (100% over 24bp)
TGAGGTAGTAGGTTGTATAGTTT142220.24591900166084377No Hit
TTCACAGTGGTTAAGTTCTGCC140330.242650917614022No Hit
TCCAGTGATGACAGCCTATAATCTGACT129330.2236303226325195No Hit
ATGACCTATGAATTGACAGCCAT126030.2179241441380688No Hit
TGTAAACATCCTACACTCAGCT126000.21787226978811922No Hit
AAGCTGCCAGCTGAAGAACT120190.20782593734788926No Hit
CATTGCACTTGTCTCGGTCTGA118770.20537055145027713No Hit
TGTAAACATCCTTGACTGGAAGC118590.2050593053505798No Hit
TGAGATGAAGCACTGTAGCT117530.2032264116523623No Hit
TGTAAACATCCCCGACTGGAAGC115730.2001139506553892No Hit
AACATTCAACGCTGTCGGTGA113350.1959985855593914No Hit
TTCAAGTAATCCAGGATAGGC113240.19580837960957634No Hit
TGGAGTGTGACAATGGTGTTTGT112890.19520317886016492No Hit
TCACAGTGAACCGGTCTCTTT110840.19165843161361218No Hit
TATTGCACTTGTCCCGGCCTGTT105820.18297812372205377No Hit
CGCCTGTCTGAGGGTCGCT104550.18078210957418941No Hit
TGAGGTAGTAGGTTGTATAGT104130.18005586867489565No Hit
TTCAAGTAATCCAGGATAGGCTT103730.17936421067556832No Hit
AACTCCAGTCACACTTGAATCTCGTAT103630.17919129617573645Illumina PCR Primer Index 8 (100% over 27bp)
TCCCATATGGTCTAGCGGTTAGGATTCC102860.1778598545270313No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT102550.17732381957755258No Hit
TACCCTGTAGAACCGAATTTGCG100770.1742459414805458No Hit
TGAGGTAGTTGGTTGTATAGTT100130.17313928868162204No Hit
TCAGTAACTGGAATCTGTCCCTGC99580.1721882589325469No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC97600.16876455183587646No Hit
CCTCGATCCAAGTTTTTGT97270.1681939339864314No Hit
TAGCTTATCAGACTGGTGTTGGCT95650.16539271908915557No Hit
TACCCTGTAGATCCGGATTTGT92790.16044736439396493No Hit
TTTTGCAGAAACGTTTCAGATT90100.15579596434848844No Hit
TGAGGTAGTTGTTTGTACAGTT89900.15545013534882474No Hit
TACCCTGTAGATCCGGATTTGTG87270.15090248400324732No Hit
CAGTCGGTAGAGCATC83190.14384757241010823No Hit
GAAGGATCATTA82080.14192822146197479No Hit
TCGTACCGTGAGTAATAATGC81060.14016449356369004No Hit
ACAGTAGTCTGCACATTGGTTA80910.13990512181394227No Hit
AACATTCATTGCTGTCGGTGGG80170.13862555451518666No Hit
ATGACCTATGAATTGACAGC78840.13632579166742317No Hit
TGTAACAGCAACTCCATGTGGA77430.1338876972197942No Hit
AAGTTCTGTGATACACTTTGACT77420.13387040576981102No Hit
AATGACACGTTTTCTCCCGGATT77220.13352457677014734No Hit
AACATTCATTGCTGTCGGTGGGT76820.13283291877081999No Hit
AAGCTGCCAGCTGAAGAACTGC76640.13252167267112266No Hit
TACGACCTCAGATCAGACGAGACAACC76100.13158793437203073No Hit
TGAGGTAGTAAGTTGTGTTGTT72980.1261930019772773No Hit
TGGAGTGTGACAATGGTGTTT72630.12558780122786586No Hit
TCCCTGAGACCCTTAACCTGTGA70990.12275200343062369No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG70600.1220776368812795No Hit
TGGACAACTCTTAGCGG69340.1198989141833983No Hit
AGCTACATCTGGCTACTGGGTCTC68580.11858476398467631No Hit
TACGACCTCAGATCAGACGAGACAACCC67040.11592188068726597No Hit
TTCACAGTGGCTAAGTTCTGCT66290.11462502193852715No Hit
CTCGATCCAAGTTTTTGT64700.1118756813912009No Hit
AAGTTCTGTGATACACTCAGACT63770.1102675765427648No Hit
CACGTTCCCGTGG63760.1102502850927816No Hit
CTACGCCTGTCTGAGGGTCGCTT62660.10834822559463136No Hit
GGCCGTGATCGTATAGTGGTTAGTACTCT62640.10831364269466498No Hit
TACGACCTCAGATCAGACGAGA62360.10782948209513583No Hit
GTCTTTGCTGCGAGCC61910.10705136684589255No Hit
GCATGAGTGACTGGTTAATCTTT61570.10646345754646427No Hit
TGTAAACATCCTACACTCTCAGC61090.10563346794727145No Hit
TCCCTGAGACCCTAACTTGTGA61040.10554701069735554No Hit
TGAGGTAGTTAGTTGTGTTGTT60490.1045959809482804No Hit
CAGGCTGGTTAGATGGTTGTCT59650.10314349914969294No Hit
GAGAGAGGCATGATCGTAGCGATAACTGA57920.1001520783026021No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GACGTTC1450.0376.855923
TAACTGC2250.0372.9677423
CAACCCG4800.0353.7230223
CGTATGC27200.0351.5705323
TAACTAA450.0346.9467223
GATTCCT45500.0329.4087823
AGTATTT254.6498826E-8312.2520423
GCTTCCT1850.0295.3735723
ATTTTCG207.4587842E-6292.736323
AGCATGC207.4587842E-6292.736323
CATAGCT3150.0291.1874423
AATAACC900.0260.2100523
CCCGACA150.0012319806260.2100523
CACACTC1000.0253.7047923
GATATCT3750.0244.5974423
GTACTCT11900.0244.3569223
CGCACTG4050.0236.1165223
CACTTCA850.0229.5970923
CCCTCTG352.4901965E-7223.0371923
AAATAGC1050.0223.0371923