FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_7_JG64_3_GATCAG_L005_R1_001_TRIMMED_prinseq_good_FxHQ.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_7_JG64_3_GATCAG_L005_R1_001_TRIMMED_prinseq_good_FxHQ.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4717950
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGTCTGAGGGTCGCT2473255.242213249398573No Hit
ATGACCTATGAATTGACAGCCA2386245.057789929948388No Hit
ATGACCTATGAATTGACAGCC2254354.778240549391155No Hit
TTCAAGTAATCCAGGATAGGCT2070484.388516198772772No Hit
AAGCTGCCAGCTGAAGAACTGT1305882.7678970739410125No Hit
TGAGGTAGTAGGTTGTATAGTT1194202.5311840947869304No Hit
TCAGTAACTGGAATCTGTCCCT940071.9925391324621924No Hit
CTACGCCTGTCTGAGGGTCGCT857501.817526680019924No Hit
TAGCTTATCAGACTGGTGTTGGC818111.734037028794286No Hit
AACATTCAACGCTGTCGGTGAGT688821.459998516304751No Hit
AACATTCAACGCTGTCGGTGAG672321.4250256997212771No Hit
TATTGCACTTGTCCCGGCCTGT661051.401138206212444No Hit
CTGTCTGAGGGTCGCT538881.1421909939698387No Hit
TGAGGTAGTAGTTTGTATAGTT502541.0651660149005395No Hit
TGTAAACATCCTTGACTGGAAGCT498171.0559035174175224No Hit
TGTCTGAGGGTCGCT418590.8872285632531078No Hit
TGGAGTGTGACAATGGTGTTTG402450.8530187899405461No Hit
TCAGTAACTGGAATCTGTCCCTGC402360.8528280291228182No Hit
TGAGATGAAGCACTGTAGCTC338100.7166248052649986No Hit
AACCCGTAGATCCGAACTTGTG327050.6932036159772783No Hit
TGTAAACATCCTACACTCTCAGCT315150.6679807967443486No Hit
CCTGTCTGAGGGTCGCTT289400.6134020072277154No Hit
GGACAACTCTTAGCGG274980.5828378850984007No Hit
TTCAAGTAATCCAGGATAGGTT262660.5567248487160738No Hit
CTGGACAACTCTTAGCGG245370.520077576065876No Hit
CCACGTTCCCGTGG244640.5185302938776375No Hit
TACGCCTGTCTGAGGGTCGCT241340.5115357305609427No Hit
TCAGTAACTGGAATCTGTCCCTG237230.5028243198846957No Hit
TGAGATGAAGCACTGTAGCTCT218150.4623830265263515No Hit
ACAGTAGTCTGCACATTGGTT215540.4568509628122384No Hit
TGAGGTAGTAGATTGAATAGTT185430.3930308714590023No Hit
TGAGGTAGTAGTTTGTGCTGTT184090.390190654839496No Hit
TGTAAACATCCCCGACTGGAAGCT177220.37562924575292234No Hit
TTCCAGTGATGACAGCCTATAATCTGACT174460.3697792473425958No Hit
TTCACAGTGGCTAAGTTCTGC171350.3631874013077714No Hit
TTCACAGTGGCTAAGTTCTG162010.34339066755688386No Hit
ACTGGACAACTCTTAGCGG160500.3401901249483356No Hit
TTCACAGTGGTTAAGTTCTG152700.3236575207452389No Hit
AACTGGACAACTCTTAGCGG141440.2997912228828199No Hit
AACTCCAGTCACGATCAGATCTCGTATGC139720.29614557169957295Illumina PCR Primer Index 9 (100% over 29bp)
AACATTCAACGCTGTCGGTGA135640.2874977479625685No Hit
CATTATTACTTTTGGTACGCG130950.27755698979429627No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC122870.2604309074916012No Hit
ATGACCTATGAATTGACAGCCAT121320.2571455822973961No Hit
CATTGCACTTGTCTCGGTCTGA120710.2558526478661283No Hit
TCGTACCGTGAGTAATAATGCA119730.25377547451753407No Hit
TCCAGTGATGACAGCCTATAATCTGACT119450.25318199641793576No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT114010.24165156476859653No Hit
TATTGCACTTGTCCCGGCCTGTT108750.23050265475471338No Hit
TGGAGTGTGACAATGGTGTTTGT106170.22503417797984293No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG106020.22471624328362955No Hit
AACTCCAGTCACGATCAGATCT105070.22270265687427804Illumina PCR Primer Index 9 (100% over 22bp)
TGAGGTAGTAGGTTGTATAGT103250.21884504922688883No Hit
TGAGGTAGTAGGTTGTATAGTTT102260.21674668023188037No Hit
TGTAAACATCCTACACTCAGCT101990.21617439777869626No Hit
TGAGATGAAGCACTGTAGCT95610.20265157536641976No Hit
TGGAGTGTGACAATGGTGTTT94980.20131624964232347No Hit
TTCAAGTAATCCAGGATAGGC94780.20089233671403894No Hit
TCACAGTGAACCGGTCTCTTT92590.19625049014932333No Hit
CGCCTGTCTGAGGGTCGCT92180.19538146864634004No Hit
TGTAAACATCCCCGACTGGAAGC91920.19483038183957013No Hit
CTACGCCTGTCTGAGGGTCGCTT86890.18416897169321422No Hit
TGAGGTAGTTGTTTGTACAGTT85960.18219777657669115No Hit
TTTTGCAGAAACGTTTCAGATT85890.18204940705179157No Hit
GAGAGAGGCATGATCGTAGCGATA85090.18035375533865344No Hit
AAGTTCTGTGATACACTCAGACT83310.17658093027692112No Hit
AGCTACATCTGGCTACTGGGTCTC83190.1763265825199504No Hit
GCATGAGTGACTGGTTAATCTTT82400.1746521264532265No Hit
TAGCTTATCAGACTGGTGTTGG81650.17306245297215953No Hit
TTCACAGTGGTTAAGTTCTGC79110.167678758782946No Hit
ACAGTAGTCTGCACATTGGTTA78700.1668097372799627No Hit
AAGCTGCCAGCTGAAGAACT77820.16494452039551077No Hit
ATGACCTATGAATTGACAGC77600.16447821617439778No Hit
TTCAAGTAATCCAGGATAGGCTT75730.16051463029493743No Hit
TGTAAACATCCTTGACTGGAAGC75390.1597939783168537No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT73640.15608474019436408No Hit
TGTAACAGCAACTCCATGTGGA70120.14862387265655633No Hit
GGCCGTGATCGTATAGTGGTTAGTACTCT66410.1407602878368783No Hit
TGAGGTAGTAAGTTGTGTTGTT65830.13953094034485317No Hit
TATTGCACTTGTCCCGGCCTGTA65420.13866191884186987No Hit
TCGTACCGTGAGTAATAATGC65340.13849235367055607No Hit
CCTCGATCCAAGTTTTTGT65240.1382803972064138No Hit
AACTCCAGTCACGATCAGATCTC64230.13613963691857692Illumina PCR Primer Index 9 (100% over 23bp)
AACATTCATTGCTGTCGGTGGGT64200.13607604997933426No Hit
AACATTCATTGCTGTCGGTGGG62690.13287550737078604No Hit
AAGTTCTGTGATACACTTTGACT62340.1321336597462881No Hit
CACGTTCCCGTGG61660.1306923557901207No Hit
TACCCTGTAGAACCGAATTTGCG61550.1304592036795642No Hit
CTGTCTGAGGGTCGCTT61270.12986572557996587No Hit
TGTAAACATCCCCGACTGGA61090.1294842039445098No Hit
TACCCTGTAGATCCGGATTTGT60280.12776735658495744No Hit
TTCACAGTGGTTAAGTTCTGCC58430.12384616199832554No Hit
AACTCCAGTCACGATCAGATCTCG57950.12282877097044267Illumina PCR Primer Index 9 (100% over 24bp)
CAAGCTCGTATCTATAGGTATG56480.11971301094755138No Hit
GAAGGATCATTA56150.11901355461588191No Hit
GAGAGAGGCATGATCGTAGC55380.11738148984198646No Hit
TCCCTGTTCGGGCGCCA55330.11727551160991533No Hit
AACCCGTAGATCCGAACTTGT55230.11706355514577306No Hit
CACCACGTTCCCGTGG55050.11668203351031699No Hit
TCAGTGCATTACAGAACTTTGT54820.11619453364278977No Hit
TGAGGTAGTTGGTTGTATAGTT54310.11511355567566423No Hit
TTTGTTCGTTCGGCTCGCGTTA53970.11439290369758051No Hit
AACTCCAGTCACGATCAGATCTCGTAT53130.11261246939878548Illumina PCR Primer Index 9 (100% over 27bp)
ACCACGTTCCCGTGG51470.1090939920940239No Hit
TCCCTGAGACCCTAACTTGTGA51420.10898801386195277No Hit
GAGAGAGGCATGATCGTAGCG50670.10739834038088576No Hit
TATTGCACTTGTCCCGGCCTGTTT50310.1066352971099736No Hit
GGCCGTGATCGTCTAGTGGTTAGGACCC49920.10580866689981877No Hit
GAGAGAGGCATGATCGTAGCGAT49540.10500323233607817No Hit
TGTAAACATCCTACACTCTCAGC47680.10106084210303203No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GAGTACC102.9900938E-4417.4280423
GTGGCCC102.9900938E-4417.4280423
GATATCC256.548362E-11417.4280423
TAACTGC2150.0388.3051823
CAACCCG2850.0388.1348323
ACCCTAC650.0385.3181823
GACGTTC1100.0379.4823
TAACTAA550.0341.53223
GATTCCT14750.0329.6974223
AGCATGC403.6379788E-12313.0710423
GATATCT3200.0306.5487423
TATCTCC5900.0304.227223
AGTATTT700.0298.162923
ATACATT354.965841E-10298.162923
TATGCCG7300.0294.4869423
GCATTCG500.0292.1996523
AAATAGC1100.0284.6100223
AATAACC1250.0283.851123
GTACTCT11450.0280.715823
CGTATGC20300.0280.684423