FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_grz_7_JG65_3_TAGCTT_L004_R1_001_TRIMMED_prinseq_good_xU1q.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_grz_7_JG65_3_TAGCTT_L004_R1_001_TRIMMED_prinseq_good_xU1q.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5868603
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT3550326.049685078373848No Hit
ATGACCTATGAATTGACAGCC3041935.183397138978391No Hit
CCTGTCTGAGGGTCGCT2979885.07766499114014No Hit
ATGACCTATGAATTGACAGCCA2897724.937665744300645No Hit
TGAGGTAGTAGGTTGTATAGTT1694722.8877741431819466No Hit
AAGCTGCCAGCTGAAGAACTGT1484872.5301933015404177No Hit
TCAGTAACTGGAATCTGTCCCT1095791.8672075790439395No Hit
AACATTCAACGCTGTCGGTGAG1071591.8259711893955002No Hit
TAGCTTATCAGACTGGTGTTGGC1037311.7675586506703553No Hit
CTACGCCTGTCTGAGGGTCGCT1009241.7197278466442523No Hit
AACATTCAACGCTGTCGGTGAGT887611.5124723890847618No Hit
TATTGCACTTGTCCCGGCCTGT869931.4823459688787946No Hit
CTGTCTGAGGGTCGCT678921.1568681677734889No Hit
TGTAAACATCCTTGACTGGAAGCT648981.10585091545637No Hit
TGAGGTAGTAGTTTGTATAGTT635421.0827449053888973No Hit
TGTCTGAGGGTCGCT582810.9930983574796249No Hit
TGGAGTGTGACAATGGTGTTTG523140.8914216892844856No Hit
TGTAAACATCCTACACTCTCAGCT435280.7417097390980443No Hit
TTCAAGTAATCCAGGATAGGTT431530.7353198026855795No Hit
AACCCGTAGATCCGAACTTGTG353080.6016423329368165No Hit
TTCCAGTGATGACAGCCTATAATCTGACT347890.5927986609419652No Hit
ACAGTAGTCTGCACATTGGTT322000.5486825399503084No Hit
TCAGTAACTGGAATCTGTCCCTGC320730.546518481485287No Hit
GGACAACTCTTAGCGG312500.532494701038731No Hit
TGAGATGAAGCACTGTAGCTC311330.530501040878042No Hit
TACGCCTGTCTGAGGGTCGCT292980.4992329520330478No Hit
CTGGACAACTCTTAGCGG268530.45757056662377743No Hit
CCACGTTCCCGTGG264390.4505160768244163No Hit
TCCAGTGATGACAGCCTATAATCTGACT256480.4370375709517239No Hit
TCAGTAACTGGAATCTGTCCCTG237830.4052582871937325No Hit
TTCACAGTGGCTAAGTTCTG235210.40079385162022374No Hit
TTCACAGTGGCTAAGTTCTGC229660.3913367457297759No Hit
TGTAAACATCCCCGACTGGAAGCT227890.3883206957430925No Hit
CCTGTCTGAGGGTCGCTT224890.3832087466131207No Hit
TGAGGTAGTAGATTGAATAGTT218920.3730359678444768No Hit
AACATTCAACGCTGTCGGTGA215000.36635635431464697No Hit
TTCACAGTGGTTAAGTTCTG209400.3568140492720329No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT199210.33945046206056195No Hit
TGAGGTAGTAGTTTGTGCTGTT194910.332123334974269No Hit
AACTCCAGTCACTAGCTTATCT190720.32498364602274166Illumina PCR Primer Index 10 (100% over 22bp)
CATTATTACTTTTGGTACGCG184380.3141803935280679No Hit
ACTGGACAACTCTTAGCGG183820.3132261630238065No Hit
TCGTACCGTGAGTAATAATGCA183660.3129535257368747No Hit
TGAGGTAGTAGGTTGTATAGTTT179790.30635911135921107No Hit
TGAGATGAAGCACTGTAGCTCT179280.30549008000711586No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC171840.29281244616478574No Hit
TGGAGTGTGACAATGGTGTTTGT169900.28950671906073727No Hit
CATTGCACTTGTCTCGGTCTGA169280.28845024957387644No Hit
ATGACCTATGAATTGACAGCCAT169070.2880924131347784No Hit
TGTAAACATCCTACACTCAGCT162830.277459558944437No Hit
TGAGGTAGTAGGTTGTATAGT160520.27352335811435874No Hit
TTCAAGTAATCCAGGATAGGC157680.26868404627131875No Hit
TATTGCACTTGTCCCGGCCTGTT157420.2682410106800545No Hit
AACTGGACAACTCTTAGCGG150320.25614273107245455No Hit
TTCAAGTAATCCAGGATAGGCTT146320.2493267988991588No Hit
TAGCTTATCAGACTGGTGTTGG143540.24458972603871826No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG140550.23949481673917966No Hit
AACTCCAGTCACTAGCTTATCTC137180.23375239388317798Illumina PCR Primer Index 10 (100% over 23bp)
TTTTGCAGAAACGTTTCAGATT136500.2325936854137177No Hit
TGTAAACATCCCCGACTGGAAGC136010.23175873372248898No Hit
TGGAGTGTGACAATGGTGTTT133670.22777141340111096No Hit
TCGTACCGTGAGTAATAATGC127160.21667848378907215No Hit
AACTCCAGTCACTAGCTTATCTCGTATGC125390.21366243380238872Illumina PCR Primer Index 10 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTA118940.20267174317294934No Hit
ACAGTAGTCTGCACATTGGTTA118750.2023479863947178No Hit
TACCCTGTAGAACCGAATTTGCG118710.20227982707298484No Hit
TGTAAACATCCTTGACTGGAAGC117370.19999648979493076No Hit
AAGCTGCCAGCTGAAGAACT113890.19406662880416342No Hit
TCACAGTGAACCGGTCTCTTT109690.1869099000222029No Hit
AACTCCAGTCACTAGCTTATCTCG106740.18188315004439728Illumina PCR Primer Index 10 (100% over 24bp)
TGAGATGAAGCACTGTAGCT105280.17939533480114433No Hit
CGCCTGTCTGAGGGTCGCT104710.17842406446644968No Hit
AAGTTCTGTGATACACTCAGACT102200.1741470670277066No Hit
TGAGGTAGTTGTTTGTACAGTT98080.16712665688921197No Hit
TCAGTGCATTACAGAACTTTGT97090.16543971367632127No Hit
TTCACAGTGGTTAAGTTCTGC97020.1653204348632886No Hit
ATGACCTATGAATTGACAGC96620.16463884164595902No Hit
GAAGGATCATTA94800.16153759250710945No Hit
TGTAAACATCCCCGACTGGA94620.16123087555931112No Hit
AACATTCATTGCTGTCGGTGGG87980.1499164281516402No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT87610.14928595442561032No Hit
AAGTTCTGTGATACACTTTGACT85400.14552015189986442No Hit
AACTCCAGTCACTAGCTTATCTCGTAT85120.14504303664773371Illumina PCR Primer Index 10 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTT84740.1443955230912706No Hit
GGCCGTGATCGTATAGTGGTTAGTACTCT84730.14437848326083738No Hit
TATTGCACTTGTCCCGGCCTGTAT84510.1440036069913061No Hit
TGAGGTAGTAAGTTGTGTTGTT83870.14291305784357877No Hit
TGTAACAGCAACTCCATGTGGA83630.14250410191318105No Hit
AGCTACATCTGGCTACTGGGTCTC83420.14214626547408302No Hit
GAGAGAGGCATGATCGTAGCGATA82630.1408001188698571No Hit
CCTCGATCCAAGTTTTTGT81730.13926653413086557No Hit
TCCCTGAGACCCTAACTTGTGA81070.13814190532227175No Hit
TACAGTACTGTGATAACTGAAG79710.1358244883833512No Hit
TACCCTGTAGATCCGGATTTGT78910.13446130194869205No Hit
CAAGCTCGTATCTATAGGTATG75490.1286336799405242No Hit
TGTAAACATCCTACACTCTCAGC74880.12759425028409657No Hit
TTCACAGTGGTTAAGTTCTGCC70780.12060791980646843No Hit
TAGCTTATCAGACTGGTGTTGGCT70070.11939809184570843No Hit
CACGTTCCCGTGG69680.1187335384588121No Hit
AACATTCATTGCTGTCGGTGGGT69620.11863129947621265No Hit
GTACAGTACTATGATAACTGAA69260.11801786558061603No Hit
CTACGCCTGTCTGAGGGTCGCTT67990.11585380711559463No Hit
AATTTTTGACGGTCTCTACGGGGACTG67630.11524037321999801No Hit
TATTGCACTTGTCCCGGCCTGTAA66830.11387718678533885No Hit
CAGTCGGTAGAGCATC66110.11265031899414563No Hit
CTCGTACCGTGAGTAATAATGC64570.11002618510742676No Hit
ATGACCTATGAATTGACAGCCT63180.10765764867720648No Hit
AAACCGTTACCATTACTGAGTTT62130.10586846648171634No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC61820.10534023173828592No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG61450.10470975801225607No Hit
CCTCCTTGCTGAATGTCGAGAACTGAGC60980.10390888598189381No Hit
TGGACAACTCTTAGCGG60310.10276721734286678No Hit
TGAGGTAGTTGGTTGTATAGTT59930.10211970378640367No Hit
GAGAGAGGCATGATCGTAGCGATAACTGA59930.10211970378640367No Hit
TACCCTGTAGAACCGAATTTGT59130.10075651735174454No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTGC2900.0408.4290823
CAACCCG3350.0401.160823
CGTATGC16600.0400.669323
GATTCCT24700.0392.847523
TAACTAA550.0372.7272323
AGTATTT700.0357.9364623
CATAGCT1850.0332.4323723
AATAACC2100.0325.3967623
TAACTAC157.754275E-4303.7036723
GTACTCT14400.0300.540123
CGCATTG507.2759576E-12273.3332823
ATTCGGC8250.0256.7676423
AGCGCCT451.3260433E-9253.086423
ATAACTA5200.0247.275722
TCTCGCC6200.0246.1469423
ACAACCC7950.0237.8530622
ATATGAC650.0232.7300722
GGATTCC44550.0223.2615422
TCGTATG17300.0219.3335322
TCACGTT7400.0218.053422