FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_12_JM104_3_GCCAAT_L004_R1_001_TRIMMED_prinseq_good_QxZ2.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_12_JM104_3_GCCAAT_L004_R1_001_TRIMMED_prinseq_good_QxZ2.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9356132
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGCCAATATCTCGTATGC250851726.811475083934262Illumina PCR Primer Index 6 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCT2870853.0684154520265428No Hit
CCTGTCTGAGGGTCGCT2523142.6967768304252226No Hit
TTCAAGTAATCCAGGATAGGCT2248942.403707001996124No Hit
ATGACCTATGAATTGACAGCC1965802.1010819428370615No Hit
AAGCTGCCAGCTGAAGAACTGT1910782.042275589955336No Hit
TGAGGTAGTAGGTTGTATAGTT1810461.935051792770773No Hit
ATGACCTATGAATTGACAGCCA1756641.8775280211950838No Hit
TGGAGTGTGACAATGGTGTTTG1582611.6915216672872935No Hit
TATTGCACTTGTCCCGGCCTGT1102751.1786387793588204No Hit
ACCACGTTCCCGTGG1098141.1737115295081344No Hit
TAGCTTATCAGACTGGTGTTGGC1007081.0763849847351448No Hit
TCAGTAACTGGAATCTGTCCCTG952811.018380245169692No Hit
AACTCCAGTCACGCCAATATCTCGTAT945721.0108023272865325Illumina PCR Primer Index 6 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGT941561.0063560454256097No Hit
AACATTCAACGCTGTCGGTGAG846680.9049466168284073No Hit
TCAGTAACTGGAATCTGTCCCTGC816230.872401116187758No Hit
CCACGTTCCCGTGG663790.7094705376110555No Hit
TGAGATGAAGCACTGTAGCTCT642620.6868436657370802No Hit
TGAGATGAAGCACTGTAGCTC629450.6727673359033413No Hit
TGGAGTGTGACAATGGTGTTTGT611270.6533362291169043No Hit
GGACAACTCTTAGCGG593190.6340120041059703No Hit
TGGAGTGTGACAATGGTGTTT583470.6236230955270832No Hit
CACCACGTTCCCGTGG583220.6233558910883258No Hit
TTCAAGTAATCCAGGATAGGTT580100.6200211796926336No Hit
CTGTCTGAGGGTCGCT570370.6096215829361963No Hit
TGTCTGAGGGTCGCT550150.5880100879294992No Hit
CTACGCCTGTCTGAGGGTCGCT538370.5754194147752512No Hit
TGAGGTAGTAGTTTGTATAGTT537140.5741047689365648No Hit
TTTGTTCGTTCGGCTCGCGTTA471880.5043537222433373No Hit
TGTAAACATCCTACACTCTCAGCT441660.47205404968634473No Hit
TGGACAACTCTTAGCGG379680.40580872522961414No Hit
TAGCAGCACGTAAATATTGGAG346870.370740814687095No Hit
AACTCCAGTCACGCCAATATCTC322310.34449065062356965Illumina PCR Primer Index 6 (100% over 23bp)
TGTAAACATCCTTGACTGGAAGCT315710.3374364534403747No Hit
TGAGGTAGTAGATTGAATAGTT308610.329847847379665No Hit
AACTCCAGTCACGCCAATATCT284320.3038862641099976Illumina PCR Primer Index 6 (100% over 22bp)
GTTCTACAGTCCGAC272320.2910604510496432Illumina DpnII expression Adapter 1 (100% over 15bp)
CCTGTCTGAGGGTCGCTT270910.2895534180150515No Hit
CTGGACAACTCTTAGCGG266850.2852140179296316No Hit
AACATTCAACGCTGTCGGTGA265710.28399556568889794No Hit
CTACAGTCCGACGATC257090.27478235664054335Illumina DpnII expression Sequencing Primer (100% over 16bp)
TAGCTTATCAGACTGGTGTTGG237990.25436793751947917No Hit
TGAGGTAGTAGGTTGTATAGT226170.2417345116550301No Hit
TTTGTTCGTTCGGCTCGCGTT226120.2416810707672786No Hit
CATTATTACTTTTGGTACGCG224550.24000302689188227No Hit
TGTAACAGCAACTCCATGTGGA224470.23991752147147988No Hit
TATTGCACTTGTCCCGGCCTGTT217270.23222203363526722No Hit
ACAGTAGTCTGCACATTGGTT211390.22593738523569357No Hit
TGAGAACTGAATTCCATAGATGG208400.2227416201481552No Hit
AACTCCAGTCACGCCAATATCTCG202920.21688449885059338Illumina PCR Primer Index 6 (100% over 24bp)
TGAGGTAGTAGGTTGTATAGTTT201400.21525989586294847No Hit
CATTGCACTTGTCTCGGTCTGA199310.21302606675493674No Hit
TGTAAACATCCTACACTCAGCT196520.21004406521840435No Hit
AAATCTCAGCTGGCGACTGTG189090.20210274929853492No Hit
TCTACAGTCCGACGATC186950.19981547930277171Illumina DpnII expression Sequencing Primer (100% over 17bp)
AACTCCAGTCACGCCAATATCTCGTATG184380.1970686176723458Illumina PCR Primer Index 6 (100% over 28bp)
TCACAGTGAACCGGTCTCTTT174380.18638044012205043No Hit
AGTTCTACAGTCCGACGATC173460.18539712778742326No Hit
TACGCCTGTCTGAGGGTCGCT173140.1850551061058138No Hit
ACAGTCCGACGATC171970.18380458933242924Illumina DpnII expression Sequencing Primer (100% over 14bp)
TTCACAGTGGCTAAGTTCTG171450.1832488040998139No Hit
TAACACTGTCTGGTAACGATGT170750.1825006316712932No Hit
TGTAAACATCCCCGACTGGAAGCT168750.18036299616123416No Hit
TGAGATGAAGCACTGTAGCT166260.1777016399512106No Hit
TGAGGTAGTAGTTTGTGCTGTT165730.17713516654104497No Hit
ACTGGACAACTCTTAGCGG160230.1712566688883825No Hit
TTCACAGTGGCTAAGTTCTGC154420.16504683773166093No Hit
TAACGGAACCCATAATGCAGCTG150640.16100670661764926No Hit
TGTAAACATCCCCGACTGGAAGC149900.1602157814789274No Hit
TACAGTCCGACGATC134120.14334983730456133Illumina DpnII expression Sequencing Primer (100% over 15bp)
TTCTACAGTCCGACGATC133830.14303988015560276Illumina DpnII expression Sequencing Primer (100% over 18bp)
CAGAGTTCTACAGTCCGACGATC132990.14214207324137795Illumina DpnII expression Sequencing Primer (100% over 23bp)
TTCACAGTGGTTAAGTTCTG132710.14184280426996967No Hit
TCGTACCGTGAGTAATAATGCA131850.1409236210006443No Hit
AACCCGTAGATCCGAACTTGTG130560.13954484609665618No Hit
TAGTTCTACAGTCCGACGATC130540.13952346974155558Illumina DpnII expression Sequencing Primer (95% over 21bp)
TACTGCATTAGGAACTGATGGA128720.13757822142740184No Hit
TAACACTGTCTGGTAACGATG128070.13688348988663265No Hit
TTCCAGTGATGACAGCCTATAATCTGACT127930.1367338554009285No Hit
AACTGGACAACTCTTAGCGG127680.13646665096217112No Hit
ATGACCTATGAATTGACAGCCAT124820.13340983218278665No Hit
TTCACAGTGGTTAAGTTCTGCC123930.13245858438081035No Hit
TTCAAGTAATCCAGGATAGGC120810.1291238729851182No Hit
TCCAGTGATGACAGCCTATAATCTGACT118620.12678316210160354No Hit
AGAGTTCTACAGTCCGACGATC114100.12195210584887003Illumina DpnII expression Sequencing Primer (100% over 22bp)
TGAGGTAGTAGGTTGTGTGGTT111950.11965414767555653No Hit
TATTGCACTTGTCCCGGCCTGTA109410.11693935057778149No Hit
AACTCCAGTCACGCCAATATCTCGT107360.11474827417997095Illumina PCR Primer Index 6 (100% over 25bp)
TTCAAGTAATCCAGGATAGG106690.11403216628410116No Hit
TGAGGTAGTTGTTTGTACAGTT106350.11366876824739112No Hit
TGAGAACTGAATTCCATAGATG105030.11225792881075214No Hit
AAATCCAGTCACGCCAATATCTCGTATGC103610.1107402075986102Illumina PCR Primer Index 6 (96% over 29bp)
TTCAAGTAATCCAGGATAGGCTT102470.10952175535787652No Hit
CACGTTCCCGTGG99960.10683902279275238No Hit
TTCAAGTAATCCAGGATAGGT95160.10170869756861063No Hit
AACTCCAGTCACGCCAATATCTCGTA94600.10111015962579407Illumina PCR Primer Index 6 (100% over 26bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTAGGC850.058.61820223
CGTATGC2657100.057.70267523
ATAACTA4500.055.13281622
TCGTATG2700700.055.1049622
TCGTAGG1000.053.56654722
CTCGTAA203.083266E-453.19289821
ACAACCC4350.053.1452722
CGGGGTG508.0035534E-1152.75638623
TAACTGC2300.052.24666223
CTCGTAT2785100.052.1319421
CGTACGC404.3301043E-851.2909323
TAACTAA404.3301043E-851.2909323
TCTCGTA2787650.051.0305820
GATAACA1050.050.65990421
ATGTCGT900.050.56894719
ATCGCGT150.00806357850.56894719
CCCTGCA7350.050.56894319
TCTTCGT1650.050.3447520
CTTCGTA1700.050.06390821
ATCTCGT2798550.049.71696519