FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_12_JM105_3_CAGATC_L005_R1_001_TRIMMED_prinseq_good_oz6e.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_12_JM105_3_CAGATC_L005_R1_001_TRIMMED_prinseq_good_oz6e.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9732734
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACCAGATCATCTCGTATGC499284851.29954234853228Illumina PCR Primer Index 7 (100% over 29bp)
ATGACCTATGAATTGACAGCC2867332.9460683914715022No Hit
ATGACCTATGAATTGACAGCCA2784202.860655597902912No Hit
TGGAGTGTGACAATGGTGTTTG2010052.065247031306928No Hit
TTCAAGTAATCCAGGATAGGCT1353561.3907294702598467No Hit
AAGCTGCCAGCTGAAGAACTGT1061171.0903102869142423No Hit
TAGCTTATCAGACTGGTGTTGGC945770.9717413421552464No Hit
TGAGGTAGTAGGTTGTATAGTT875120.899151255957473No Hit
TGGAGTGTGACAATGGTGTTT860840.8844791196389421No Hit
GTTCTACAGTCCGAC700590.7198285702660732Illumina DpnII expression Adapter 1 (100% over 15bp)
TGGAGTGTGACAATGGTGTTTGT678020.6966387861827931No Hit
AACTCCAGTCACCAGATCATCTCGTAT676080.694645512761368Illumina PCR Primer Index 7 (100% over 27bp)
CCTGTCTGAGGGTCGCT516640.5308272064149703No Hit
TATTGCACTTGTCCCGGCCTGT516470.530652538125464No Hit
CTACAGTCCGACGATC481410.4946297720661018Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGTAACAGCAACTCCATGTGGA451530.4639292515340499No Hit
AGTTCTACAGTCCGACGATC449060.46139142403357575No Hit
TGAGATGAAGCACTGTAGCTC435000.44694532903087664No Hit
AACATTCAACGCTGTCGGTGAGT425150.4368248428447752No Hit
TGAGATGAAGCACTGTAGCTCT406850.4180223152096831No Hit
ACCACGTTCCCGTGG403020.41408714139315844No Hit
TCAGTAACTGGAATCTGTCCCT394730.40556949362840905No Hit
TTCAAGTAATCCAGGATAGGTT385750.39634289810036927No Hit
AACATTCAACGCTGTCGGTGAG379880.39031170480976873No Hit
TAACGGAACCCATAATGCAGCTG369390.37953364388670235No Hit
TGTAAACATCCTACACTCTCAGCT346620.3561383676981206No Hit
TAGTTCTACAGTCCGACGATC335350.3445588875643781Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGTAAACATCCTTGACTGGAAGCT317500.32621871716621453No Hit
TCTACAGTCCGACGATC310940.31947857611232366Illumina DpnII expression Sequencing Primer (100% over 17bp)
ACAGTCCGACGATC296580.30472424295167216Illumina DpnII expression Sequencing Primer (100% over 14bp)
TGAGGTAGTAGTTTGTATAGTT288130.29604220150268157No Hit
CAGAGTTCTACAGTCCGACGATC271700.27916102505215906Illumina DpnII expression Sequencing Primer (100% over 23bp)
TTCTACAGTCCGACGATC265210.2724928062351237Illumina DpnII expression Sequencing Primer (100% over 18bp)
CACCACGTTCCCGTGG264260.2715167187349413No Hit
AGAGTTCTACAGTCCGACGATC244760.2514812384680399Illumina DpnII expression Sequencing Primer (100% over 22bp)
TAGCTTATCAGACTGGTGTTGG234270.24070317754497347No Hit
TGAGAACTGAATTCCATAGATGG232430.2388126501761992No Hit
TACAGTCCGACGATC230970.23731255780749788Illumina DpnII expression Sequencing Primer (100% over 15bp)
TCAGTAACTGGAATCTGTCCCTG222900.22902095135858025No Hit
TAGCAGCACGTAAATATTGGAG220010.2260515904369728No Hit
GTTCTACAGTCCGACG211170.2169688393826442Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGGTAGTAGATTGAATAGTT184740.189813057667044No Hit
TTTGTTCGTTCGGCTCGCGTTA158530.16288331726727556No Hit
TAACACTGTCTGGTAACGATGT158230.16257507910932323No Hit
AACTCCAGTCACCAGATGATCTCGTATGC142460.14637202660629584Illumina PCR Primer Index 7 (96% over 29bp)
TGTAAACATCCTACACTCAGCT140500.14435820397434063No Hit
TGTAACAGCAACTCCATGTGGAA140370.1442246341058946No Hit
ATGACCTATGAATTGACAGCCAT138470.14227245910552985No Hit
AACTCCAGTCACAAGATCATCTCGTATGC135590.1393133727891875Illumina PCR Primer Index 7 (96% over 29bp)
ACAGTAGTCTGCACATTGGTT131190.13479254647255334No Hit
CATTATTACTTTTGGTACGCG129070.1326143301563569No Hit
TGAGAACTGAATTCCATAGATG124340.12775444186597518No Hit
AACTCCAGTCACCAGATCATCTCGTATG120590.12390146489157106Illumina PCR Primer Index 7 (100% over 28bp)
TGTCTGAGGGTCGCT119770.1230589472598347No Hit
AACTCCAGTCAACAGATCATCTCGTATGC119140.1224116471281348Illumina PCR Primer Index 7 (96% over 29bp)
TTCACAGTGGTTAAGTTCTGCC118570.12182599462802537No Hit
TCAGTAACTGGAATCTGTCCCTGC116680.11988409423292572No Hit
TCACAGTGAACCGGTCTCTTT114020.11715104923241505No Hit
AACTCCAGTCACCAGATCTCGTATGCCGT111490.11455157410035041No Hit
CTGTCTGAGGGTCGCT110170.11319532620536017No Hit
TTCACAGTGGTTAAGTTCTG107920.11088354002071771No Hit
CATTGCACTTGTCTCGGTCTGA105710.10861285225713556No Hit
AACATTCAACGCTGTCGGTGA104730.10760594094115795No Hit
CTACGCCTGTCTGAGGGTCGCT104520.10739017423059133No Hit
TGTAAACATCCCCGACTGGAAGCT103530.10637298830934863No Hit
TGAGGTAGTAGGTTGTATAGTTT103520.10636271370408357No Hit
TGAGATGAAGCACTGTAGCT103400.10623941844090264No Hit
AACTCCAGTCACCAGATCATCTCGTA97760.10044454107139886Illumina PCR Primer Index 7 (100% over 26bp)

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTTATGC251.6123752E-435.3563923
TAACTAA251.6123752E-435.3563923
CGTATGC5274850.034.6442223
ATAACTA2750.034.26658622
CTTCGTA1650.034.2087321
TCGTATG5314600.034.05630522
ACAACCC5750.033.99069222
TCTTCGT1700.033.9029420
ACACCCC200.002829278133.9029420
TAACTGC1150.033.8191623
CCCTGCA900.033.620419
GTCTCGT1000.033.620419
ACCTCGT553.8198777E-1133.620419
ATCGCGT351.1925495E-633.620419
GCCGTCT6000.033.58857323
CTCGTAT5366000.033.48993721
GACAACC8950.033.25317821
TCTCGTA5366300.033.24431220
GCGATAA11600.033.18565819
AGACAAC9450.033.0060320