FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_12_JM106_3_ACTTGA_L007_R1_001_TRIMMED_prinseq_good_2zZS.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_12_JM106_3_ACTTGA_L007_R1_001_TRIMMED_prinseq_good_2zZS.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8520685
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGTCTGAGGGTCGCT4794705.627129743676711No Hit
ATGACCTATGAATTGACAGCC4233804.968849335470094No Hit
TTCAAGTAATCCAGGATAGGCT4223234.956444229542578No Hit
TGAGGTAGTAGGTTGTATAGTT3764354.417895979020466No Hit
ATGACCTATGAATTGACAGCCA3623514.2526041040127645No Hit
AAGCTGCCAGCTGAAGAACTGT2867913.3658209404525574No Hit
TCAGTAACTGGAATCTGTCCCT2851133.3461276880908044No Hit
TATTGCACTTGTCCCGGCCTGT1734602.0357518204228886No Hit
AACATTCAACGCTGTCGGTGAG1518441.782063296554209No Hit
AACATTCAACGCTGTCGGTGAGT1477731.7342854477075496No Hit
CTACGCCTGTCTGAGGGTCGCT1379591.619106914526238No Hit
TAGCTTATCAGACTGGTGTTGGC1198401.4064596919144412No Hit
TGAGGTAGTAGTTTGTATAGTT1165981.36841110779239No Hit
CTGTCTGAGGGTCGCT1154981.3555013476029216No Hit
AACTCCAGTCACACTTGAATCTCGTATGC1119201.3135094185502691Illumina PCR Primer Index 8 (100% over 29bp)
TGTCTGAGGGTCGCT860391.0097662335833328No Hit
TGTAAACATCCTACACTCTCAGCT661790.7766863814352953No Hit
TTTGTTCGTTCGGCTCGCGTTA614060.7206697583586297No Hit
TTCAAGTAATCCAGGATAGGTT570760.6698522477946316No Hit
TCAGTAACTGGAATCTGTCCCTGC537940.6313342178475088No Hit
TGAGATGAAGCACTGTAGCTC507220.5952807784820117No Hit
TGTAAACATCCTTGACTGGAAGCT504450.592029866143391No Hit
TGAGGTAGTAGATTGAATAGTT503430.5908327792894585No Hit
TCAGTAACTGGAATCTGTCCCTG488970.573862312713121No Hit
AACCCGTAGATCCGAACTTGTG469030.550460438333303No Hit
CCTGTCTGAGGGTCGCTT465910.5467987608977447No Hit
TGGAGTGTGACAATGGTGTTTG440260.51669554736503No Hit
CTGGACAACTCTTAGCGG437240.5131512313857395No Hit
TGAGGTAGTAGGTTGTATAGT404440.4746566737298703No Hit
TGAGGTAGTAGGTTGTATAGTTT401040.47066638421676193No Hit
TGAGATGAAGCACTGTAGCTCT381840.44813298461332624No Hit
CCACGTTCCCGTGG380900.4470297869244081No Hit
ACAGTAGTCTGCACATTGGTT372400.4370540631416371No Hit
GGACAACTCTTAGCGG364970.4283341069409326No Hit
TTTGTTCGTTCGGCTCGCGTT354890.4165040721491289No Hit
TGAGGTAGTAGTTTGTGCTGTT351800.41287760315045097No Hit
TTCACAGTGGCTAAGTTCTG343760.4034417420665123No Hit
TTCACAGTGGCTAAGTTCTGC342700.40219771063007254No Hit
AACTCCAGTCACACTTGAATCT339310.398219157262591Illumina PCR Primer Index 8 (100% over 22bp)
TACGCCTGTCTGAGGGTCGCT328620.38567321758755313No Hit
AACATTCAACGCTGTCGGTGA319400.37485249131965326No Hit
TATTGCACTTGTCCCGGCCTGTT307800.3612385623925776No Hit
CATTGCACTTGTCTCGGTCTGA299010.3509224903866297No Hit
ACTGGACAACTCTTAGCGG245100.28765292931260805No Hit
ATGACCTATGAATTGACAGCCAT243360.28561083997354675No Hit
TTCCAGTGATGACAGCCTATAATCTGACT240160.2818552733729741No Hit
TTCACAGTGGTTAAGTTCTG232090.27238420385215506No Hit
TGTAAACATCCCCGACTGGAAGCT228710.26841738663030024No Hit
TTCAAGTAATCCAGGATAGGC226520.2658471707380334No Hit
TATTGCACTTGTCCCGGCCTGTA223340.26211507642871434No Hit
TCACAGTGAACCGGTCTCTTT220690.2590049978376152No Hit
AACTCCAGTCACACTTGAATCTC220290.2585355520125436Illumina PCR Primer Index 8 (100% over 23bp)
AAGCTGCCAGCTGAAGAACT210130.2466116280557256No Hit
TCGTACCGTGAGTAATAATGCA209920.246365168997563No Hit
AACTGGACAACTCTTAGCGG202740.2379386164375282No Hit
TAACGGAACCCATAATGCAGCTG200750.2356031234577971No Hit
TTCAAGTAATCCAGGATAGGCTT199700.23437082816698424No Hit
TCCAGTGATGACAGCCTATAATCTGACT189140.2219774583850946No Hit
CATTATTACTTTTGGTACGCG184860.21695438805682873No Hit
TGTAAACATCCTACACTCAGCT176080.20665005219650767No Hit
GAAGGATCATTA173920.20411504474112116No Hit
TAGCTTATCAGACTGGTGTTGG169360.19876336233530517No Hit
ATGACCTATGAATTGACAGC166510.19541856083167022No Hit
AGCTACATCTGGCTACTGGGTCTC157230.18452741769000966No Hit
TGAGATGAAGCACTGTAGCT154430.18124129691450863No Hit
TATTGCACTTGTCCCGGCCTGTAT152310.1787532340416293No Hit
TACCCTGTAGATCCGGATTTGT151330.17760309177020392No Hit
AACTCCAGTCACACTTGAATCTCG150970.17718059052763951Illumina PCR Primer Index 8 (100% over 24bp)
AAGGTCCAACCTCACATGTCCT146650.1721105756168665No Hit
TGGAGTGTGACAATGGTGTTTGT143860.16883619098699224No Hit
TGTAACAGCAACTCCATGTGGA141990.16664153175478263No Hit
TCGTACCGTGAGTAATAATGC141430.1659843075996824No Hit
CGCCTGTCTGAGGGTCGCT139180.1633436748336548No Hit
TGAGGTAGTAGGTTGTGTGGTT131760.15463545477857707No Hit
GGAATACCAGGTGCTGTAAGCTT131090.15384913302158218No Hit
AAACCGTTACCATTACTGAGTTT125020.14672529262612102No Hit
TGTAAACATCCCCGACTGGAAGC124440.14604459617976726No Hit
TATTGCACTTGTCCCGGCCTGTTT121860.14301667060805556No Hit
TGAGGTAGTTGTTTGTACAGTT121020.14203083437540526No Hit
TGGAGTGTGACAATGGTGTTT120800.1417726391716159No Hit
CTACGCCTGTCTGAGGGTCGCTT114960.1349187301255709No Hit
TATTGCACTTGTCCCGGCCTGTAA114190.13401504691230812No Hit
AACATTCATTGCTGTCGGTGGG114050.13385074087353305No Hit
ACAGTAGTCTGCACATTGGTTA112780.13236025037893082No Hit
CTGTCTGAGGGTCGCTT110140.1292619079334584No Hit
GTCTGAGGGTCGCT108670.12753669452632035No Hit
TGTAAACATCCTACACTCTCAGC108060.12682078964308618No Hit
TGAGGTAGTAGTTTGTATAGT106720.12524814612909643No Hit
AACATTCATTGCTGTCGGTGGGT106260.12470828343026412No Hit
TACCCTGTAGATCCGGATTTGTG105810.1241801568770586No Hit
AACTCCAGTCACACTTGAATCTCGTAT104750.12293612544061892Illumina PCR Primer Index 8 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGC102910.12077667464528968No Hit
CACGTTCCCGTGG102000.11970868539325184No Hit
TCCCTGAGACCCTAACTTGTGA101090.11864069614121399No Hit
GAATACCAGGTGCTGTAAGCTT100720.11820645875302278No Hit
TGAGGTAGTTGGTTGTATAGTT99840.11717367793786532No Hit
AAGGTCCAACCTCACATGTCC99460.11672770440404732No Hit
CAGGCTGGTTAGATGGTTGTCT98500.11560103442387554No Hit
TTCACAGTGGCTAAGTTCTGCT95950.11260831728904426No Hit
CCAGGTGCTGTAAGCTT94740.11118824366820274No Hit
TGTAAACATCCTTGACTGGAAGC94240.11060143638686327No Hit
TGAGGTAGTAAGTTGTGTTGTT91500.10738573248512295No Hit
GAAAGTCAGCCCTCGATCCAAGTTTTTGT90820.10658767458250129No Hit
TGGACAACTCTTAGCGG90140.10578961667987961No Hit
ATGACCTATGAATTGACAGCCT89370.10488593346661683No Hit
TGTAAACATCCCCGACTGGA87490.10267953808878041No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC121350.0515.4598423
TAACTGC3750.0501.770423
TAACTAA600.0492.8101823
CAACCCG1750.0491.5301523
GATTCCT3900.0441.116823
AATAACC1700.0379.490223
TACTTCC104.1654045E-4373.7581522
ATCACTA104.1654045E-4373.7581522
AAAAACC104.1654045E-4373.7581522
ATAACTA7750.0368.9354222
CGTAGGC154.722171E-4358.407423
TAACTAC154.722171E-4358.407423
TCGTATG122700.0356.852222
ACAACCC7050.0355.202822
AAATAGC1900.0339.5438523
ATATGAC303.8380676E-10311.4651222
GGATTCC5200.0301.881622
GCGGTGT108.9432305E-4289.6166721
TTACTTC108.9432305E-4289.6166721
AGGCATA108.9432305E-4289.6166721