FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_12_JM107_3_GATCAG_L006_R1_001_TRIMMED_prinseq_good_fizM.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_12_JM107_3_GATCAG_L006_R1_001_TRIMMED_prinseq_good_fizM.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8367930
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGATCAGATCTCGTATGC462438055.26312959118922Illumina PCR Primer Index 9 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTG1786392.1348051429684523No Hit
ATGACCTATGAATTGACAGCCA1531861.8306319484030102No Hit
ATGACCTATGAATTGACAGCC1458921.7434658272714996No Hit
AAGCTGCCAGCTGAAGAACTGT1249761.4935115375009114No Hit
TTCAAGTAATCCAGGATAGGCT1229451.469240301962373No Hit
TGAGGTAGTAGGTTGTATAGTT1019131.2178997673259695No Hit
AACTCCAGTCACGATCAGATCTCGTAT902561.078594108698328Illumina PCR Primer Index 9 (100% over 27bp)
TGGAGTGTGACAATGGTGTTT835490.9984428646033128No Hit
CCTGTCTGAGGGTCGCT658170.7865386063219937No Hit
TGGAGTGTGACAATGGTGTTTGT625250.7471979330611035No Hit
TAGCTTATCAGACTGGTGTTGGC512980.6130309407463973No Hit
TATTGCACTTGTCCCGGCCTGT470340.5620744915409187No Hit
AACATTCAACGCTGTCGGTGAGT408180.48779088735206916No Hit
AACATTCAACGCTGTCGGTGAG389820.4658499772345132No Hit
TTCAAGTAATCCAGGATAGGTT384150.4590741079335033No Hit
TGTAAACATCCTTGACTGGAAGCT336720.40239342346315043No Hit
GTTCTACAGTCCGAC307390.3673429390542225Illumina DpnII expression Adapter 1 (100% over 15bp)
ACCACGTTCCCGTGG300800.35946763416997995No Hit
TGAGGTAGTAGTTTGTATAGTT297830.35591836929802234No Hit
TGTAAACATCCTACACTCTCAGCT269880.32251703826394346No Hit
GGACAACTCTTAGCGG255580.30542798517674025No Hit
AACTCCAGTCACGGTCAGATCTCGTATGC233840.2794478443294817Illumina PCR Primer Index 9 (96% over 29bp)
CTACAGTCCGACGATC221470.26466521588971226Illumina DpnII expression Sequencing Primer (100% over 16bp)
TCAGTAACTGGAATCTGTCCCT201570.24088394620891906No Hit
TGGACAACTCTTAGCGG186960.2234244311317136No Hit
AACTCCAGTCACGATCAGATCT186040.22232499554848095Illumina PCR Primer Index 9 (100% over 22bp)
AGTTCTACAGTCCGACGATC173470.2073033593732261No Hit
CTACGCCTGTCTGAGGGTCGCT165630.19793425614220003No Hit
AACTCCAGTCACGATCAGATCTCGTATG164420.1964882593425136Illumina PCR Primer Index 9 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTT161600.19311825027217006No Hit
TCTACAGTCCGACGATC160220.19146909689732108Illumina DpnII expression Sequencing Primer (100% over 17bp)
AACTCCAGTGACGATCAGATCTCGTATGC159180.19022625667279722Illumina PCR Primer Index 9 (96% over 29bp)
TGTCTGAGGGTCGCT157100.18774057622374948No Hit
CTGTCTGAGGGTCGCT149710.17890924039756548No Hit
ACAGTCCGACGATC147180.17588579254367567Illumina DpnII expression Sequencing Primer (100% over 14bp)
TGTAACAGCAACTCCATGTGGA147070.17575433828915873No Hit
TAGCTTATCAGACTGGTGTTGG146360.1749058608281857No Hit
TAGCAGCACGTAAATATTGGAG142020.16971939296815342No Hit
AACTCCAGTCACGATCAGATCTC135470.16189188963100792Illumina PCR Primer Index 9 (100% over 23bp)
AACTCCAGTCACGATCCGATCTCGTATGC129190.15438704673676765Illumina PCR Primer Index 9 (96% over 29bp)
ACAGTAGTCTGCACATTGGTT129060.15423169170870216No Hit
CATTATTACTTTTGGTACGCG128820.15394488242611973No Hit
CACCACGTTCCCGTGG128460.15351466850224607No Hit
TAGTTCTACAGTCCGACGATC123930.14810114329350269Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGTAAACATCCTACACTCAGCT123400.1474677727944665No Hit
CAGAGTTCTACAGTCCGACGATC118840.1420183964254003Illumina DpnII expression Sequencing Primer (100% over 23bp)
TACAGTCCGACGATC117760.14072775465377937Illumina DpnII expression Sequencing Primer (100% over 15bp)
TGAGGTAGTAGTTTGTGCTGTT116050.13868423851537956No Hit
TTCTACAGTCCGACGATC115400.13790746337505214Illumina DpnII expression Sequencing Primer (100% over 18bp)
TGAGGTAGTAGGTTGTATAGTTT114980.13740554713053288No Hit
AACTCCAGTCACGATAAGATCTCGTATGC114150.13641366502826863Illumina PCR Primer Index 9 (96% over 29bp)
ATGACCTATGAATTGACAGCCAT109500.13085673517823404No Hit
AAATCCAGTCACGATCAGATCTCGTATGC103450.12362675117980194Illumina PCR Primer Index 9 (96% over 29bp)
GTTCTACAGTCCGACG100720.12036429559042679Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGGTAGTAGGTTGTATAGT95360.11395888827941916No Hit
AGAGTTCTACAGTCCGACGATC94850.11334941855393149Illumina DpnII expression Sequencing Primer (100% over 22bp)
TGAGATGAAGCACTGTAGCTC94420.11283555192263797No Hit
CCTGTCTGAGGGTCGCTT93870.11217828065005324No Hit
CTGGACAACTCTTAGCGG93850.1121543798765047No Hit
AACATTCAACGCTGTCGGTGA93630.1118914713674708No Hit
TAACACTGTCTGGTAACGATGT93160.1113298031890802No Hit
TGAGAACTGAATTCCATAGATGG92860.11097129158585217No Hit
TTCACAGTGGCTAAGTTCTG92830.11093544042552936No Hit
TGTAAACATCCCCGACTGGAAGCT92610.11067253191649547No Hit
TCACAGTGAACCGGTCTCTTT90750.10844975997648164No Hit
AACTCCAGTCACGATCAGATCTCGTA90210.10780443909067117Illumina PCR Primer Index 9 (100% over 26bp)
TATTGCACTTGTCCCGGCCTGTT85610.10230726117450792No Hit
TTCAAGTAATCCAGGATAGG85460.10212800537289389No Hit
CATTGCACTTGTCTCGGTCTGA85320.10196069995805414No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATATGC301.6423433E-533.50234223
CATGCCC200.002998973733.50234223
AGTATGC505.2386895E-1033.50234223
GGTATGC351.2257497E-633.50234223
CGTACGC750.033.50234223
CGTGTGC1250.033.50234223
TAACTGC700.033.50234223
CGTATGC4865150.033.08056323
CGTAGGC3150.032.9705623
ATAACTA3700.032.60033422
TCGTATG4907500.032.48193422
ACAACCC5000.032.38597522
GATAACA401.3117096E-732.1728421
CTAGTAT351.6817721E-632.1728421
CTCATAT302.1665208E-532.1728421
CGCGTAT302.1665208E-532.1728421
TCGCATA200.003820750931.88626720
TCGCGTA302.3031838E-531.88626520
CTCGTAT4985100.031.71300721
CCCTGCA451.2141754E-831.62549219