FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_12_JM115_3_TAGCTT_L008_R1_001_TRIMMED_prinseq_good_fTIG.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_12_JM115_3_TAGCTT_L008_R1_001_TRIMMED_prinseq_good_fTIG.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13039666
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACTAGCTTATCTCGTATGC535877941.0959835934448Illumina PCR Primer Index 10 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCT2518061.9310770689985466No Hit
TGGAGTGTGACAATGGTGTTTG2137091.6389146777225736No Hit
ATGACCTATGAATTGACAGCC2130161.6336001244203646No Hit
ATGACCTATGAATTGACAGCCA1880501.4421381651953356No Hit
TAGCTTATCAGACTGGTGTTGGC1368581.0495514225594427No Hit
AAGCTGCCAGCTGAAGAACTGT1295720.9936757582594524No Hit
TGAGGTAGTAGGTTGTATAGTT1261670.967563126233448No Hit
AACTCCAGTCACTAGCTTATCTCGTAT1066810.8181267833087137Illumina PCR Primer Index 10 (100% over 27bp)
TGGAGTGTGACAATGGTGTTT1027820.7882257106892155No Hit
TATTGCACTTGTCCCGGCCTGT1010360.7748357971745595No Hit
TGGAGTGTGACAATGGTGTTTGT844360.6475319229802359No Hit
TCAGTAACTGGAATCTGTCCCT800600.613972781204672No Hit
CCTGTCTGAGGGTCGCT716520.5494926020344386No Hit
ACCACGTTCCCGTGG695830.533625631208652No Hit
GTTCTACAGTCCGAC678250.5201436907969882Illumina DpnII expression Adapter 1 (100% over 15bp)
AACATTCAACGCTGTCGGTGAG676130.5185178822831812No Hit
TAACGGAACCCATAATGCAGCTG674140.5169917695744661No Hit
TTCAAGTAATCCAGGATAGGTT655300.5025435467442187No Hit
AACATTCAACGCTGTCGGTGAGT606000.46473582989012147No Hit
TGAGATGAAGCACTGTAGCTC539600.4138142802123919No Hit
TGAGATGAAGCACTGTAGCTCT475490.3646489104858974No Hit
CTACAGTCCGACGATC458180.3513740305925014Illumina DpnII expression Sequencing Primer (100% over 16bp)
CACCACGTTCCCGTGG455500.3493187632259906No Hit
TGTAAACATCCTTGACTGGAAGCT454470.3485288656933391No Hit
TGTAAACATCCTACACTCTCAGCT452770.34722515131905984No Hit
TGAGGTAGTAGTTTGTATAGTT445370.3415501593369033No Hit
GGACAACTCTTAGCGG396960.3044249753022815No Hit
TAGCTTATCAGACTGGTGTTGG396560.30411821897892166No Hit
ACTCCAGTCACTAGCTTATCTCGTATGCC369370.2832664578985382Illumina PCR Primer Index 10 (100% over 29bp)
TGGACAACTCTTAGCGG345760.2651601659122251No Hit
TGAGAACTGAATTCCATAGATGG338450.25955419410282443No Hit
TCTACAGTCCGACGATC338090.25927811341180057Illumina DpnII expression Sequencing Primer (100% over 17bp)
AACTCCATCACTAGCTTATCTCGTATGCC337090.25851122260340104Illumina PCR Primer Index 10 (95% over 23bp)
AGTTCTACAGTCCGACGATC330300.2533040340143682No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT312720.23982209360270423No Hit
TCAGTAACTGGAATCTGTCCCTG308030.2362253757113104No Hit
ACAGTCCGACGATC289560.2220609024801709Illumina DpnII expression Sequencing Primer (100% over 14bp)
AACTCCAGTCACTAGCTTACTCGTATGCC283650.2175285778025296No Hit
TTCTACAGTCCGACGATC248300.19041898772560586Illumina DpnII expression Sequencing Primer (100% over 18bp)
TAGCAGCACGTAAATATTGGAG244520.1875201404698556No Hit
AACTCCAGTCACTAGCTTATCT243610.18682226983421202Illumina PCR Primer Index 10 (100% over 22bp)
TACAGTCCGACGATC241850.18547254201142882Illumina DpnII expression Sequencing Primer (100% over 15bp)
TGTAAACATCCTACACTCAGCT241760.18540352183867287No Hit
TAGTTCTACAGTCCGACGATC226160.17344002522764004Illumina DpnII expression Sequencing Primer (95% over 21bp)
TAACACTGTCTGGTAACGATGT225660.17305657982344028No Hit
AACTCCAGTCACTTGCTTATCTCGTATGC224800.17239705372821668Illumina PCR Primer Index 10 (96% over 29bp)
TGAGAACTGAATTCCATAGATG222710.17079425193866163No Hit
GTTCTACAGTCCGACG221320.16972827371498628Illumina DpnII expression Sequencing Primer (100% over 16bp)
CATTATTACTTTTGGTACGCG217000.16641530542270025No Hit
CAGAGTTCTACAGTCCGACGATC208790.16011913188574Illumina DpnII expression Sequencing Primer (100% over 23bp)
ACAGTAGTCTGCACATTGGTT207770.15933690326117247No Hit
TGTAACAGCAACTCCATGTGGA207690.15927555199650054No Hit
TTCACAGTGGCTAAGTTCTG204990.15720494681382177No Hit
AATCCAGTCACTAGCTTATCTCGTATGCC200610.15384596507303178Illumina PCR Primer Index 10 (96% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTC198880.15251924397450056No Hit
TATTGCACTTGTCCCGGCCTGTT196850.1509624556334495No Hit
TTCACAGTGGTTAAGTTCTG194750.14935198493581048No Hit
TGTCTGAGGGTCGCT177530.1361461252151704No Hit
AACATTCAACGCTGTCGGTGA172170.13203559048214886No Hit
CATTGCACTTGTCTCGGTCTGA171560.13156778708902514No Hit
TTCACAGTGGTTAAGTTCTGCC169180.1297425869650342No Hit
TTCACAGTGGCTAAGTTCTGC168150.1289526894323827No Hit
AGAGTTCTACAGTCCGACGATC167600.12853089948776295Illumina DpnII expression Sequencing Primer (100% over 22bp)
TGAGGTAGTAGATTGAATAGTT167430.12840052805033503No Hit
TGAGATGAAGCACTGTAGCT165760.1271198204003078No Hit
AACTCCAGTCACTAGCTTATCTCGTATG160510.12309364365621021Illumina PCR Primer Index 10 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTT157380.12069327542591965No Hit
TTCAAGTAATCCAGGATAGG155680.11938956105164043No Hit
CTACGCCTGTCTGAGGGTCGCT151430.11613027511594239No Hit
TAACACTGTCTGGTAACGATG150610.11550142465305477No Hit
TCACAGTGAACCGGTCTCTTT149360.11454281114255535No Hit
CTGTCTGAGGGTCGCT149350.11453514223447134No Hit
ATGACCTATGAATTGACAGCCAT148290.11372223797756784No Hit
TGAGGTAGTAGGTTGTATAGT147740.11330044803294807No Hit
CTGGACAACTCTTAGCGG143620.11014085790234199No Hit
TCAGTAACTGGAATCTGTCCCTGC142240.10908254858675061No Hit
AACTCCAGTCACTAGCTTATCTC133420.10231857165666668Illumina PCR Primer Index 10 (100% over 23bp)
TGTAAACATCCCCGACTGGAAGCT131480.10083080348837156No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATGGCG256.90118E-540.838323
TATGCCC200.001134381440.838323
TAGTATG1100.039.3981422
ATAACTA2500.039.39813622
CGTATGC5759700.039.2280823
AGTATGC1100.038.98201423
TAACTGC950.038.6889223
AATAACC1300.037.6968923
TCGTATG5812850.037.66404722
CTAGTAT1000.037.639521
GTCGTAT551.0913936E-1137.639521
CGTAGGC1650.037.1257323
AGGCTTC2750.036.95514321
TCGTACG750.036.77159522
TGTCGTA551.4551915E-1136.68787420
CGATAAA2350.036.68787420
CGATCAC900.036.6878720
ACAACCC20450.036.50829722
GCCGTCT1350.036.30071323
CTCGTAT5906450.036.11389521