FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_20_JM75_3_GGCTAC_L004_R1_001_TRIMMED_prinseq_good_M_tT.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_20_JM75_3_GGCTAC_L004_R1_001_TRIMMED_prinseq_good_M_tT.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11401962
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGGCTACATCTCGTATGC534192946.850963018469976Illumina PCR Primer Index 11 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGC3117582.7342487196501795No Hit
TAACGGAACCCATAATGCAGCTG2471902.167960215969848No Hit
TTCAAGTAATCCAGGATAGGCT2334452.0474107877223235No Hit
TGAGAACTGAATTCCATAGATGG1972291.7297812429124042No Hit
AACTCCAGTCACGGCTACATCTCGTAT1109650.9732096984711929Illumina PCR Primer Index 11 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGT1099890.9646497681714779No Hit
AACATTCAACGCTGTCGGTGAGT1086110.9525641288753637No Hit
TGAGGTAGTAGGTTGTATAGTT1004020.8805677479016332No Hit
TGAGAACTGAATTCCATAGATG954990.8375663767341094No Hit
AACATTCAACGCTGTCGGTGAG943650.827620720012924No Hit
TAGCTTATCAGACTGGTGTTGG891520.7819005185247943No Hit
TATTGCACTTGTCCCGGCCTGT832270.7299357777196591No Hit
TGGAGTGTGACAATGGTGTTTG650300.5703404379000737No Hit
ATGACCTATGAATTGACAGCC620710.5443887639688678No Hit
TTCAAGTAATCCAGGATAGGTT580000.5086843825650358No Hit
ATGACCTATGAATTGACAGCCA524030.45959633964750984No Hit
CCTGTCTGAGGGTCGCT523550.4591753594688353No Hit
TGTAAACATCCTTGACTGGAAGCT507050.4447041658268989No Hit
TGTAAACATCCTACACTCTCAGCT442750.3883103627252924No Hit
GTTCTACAGTCCGAC438530.3846092453211123Illumina DpnII expression Adapter 1 (100% over 15bp)
TGAGGTAGTAGTTTGTATAGTT410350.35989420066476274No Hit
TAGCAGCACGTAAATATTGGAG371620.3259263624979631No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC349140.30621045746337344No Hit
ACCACGTTCCCGTGG345800.3032811370534299No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT345300.3028426160339773No Hit
TGGAGTGTGACAATGGTGTTTGT307830.2699798508361982No Hit
CTACAGTCCGACGATC293230.2571750370681818Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGATGAAGCACTGTAGCTCT273740.24008148772991875No Hit
TTCCCTTTGTCATCCTATGCCT268870.23581029300045026No Hit
AATGACACGTTTTCTCCCGGATT254670.22335629604799595No Hit
AAATCCAGTCACGGCTACATCTCGTATGC253450.22228630476053157Illumina PCR Primer Index 11 (96% over 29bp)
TACCCTGTAGATCCGGATTTGTG253180.22204950341002716No Hit
TTCACAGTGGCTAAGTTCTGC250390.21960255612148155No Hit
TGAGAACTGAATTCCATAGAT249260.21861149861751866No Hit
TGAGAACTGAATTCCATAGATGGT236700.2075958506088689No Hit
TGTAAACATCCTACACTCAGCT236590.2074993759845893No Hit
TCAGTAACTGGAATCTGTCCCT234930.20604348620000662No Hit
AACAGTAAGAGTTTATGTGCTG232350.2037807177396311No Hit
AGTTCTACAGTCCGACGATC231090.20267564477061054No Hit
TGGAGTGTGACAATGGTGTTT229470.20125483666758406No Hit
CATTATTACTTTTGGTACGCG215880.18933583535886192No Hit
TTCACAGTGGCTAAGTTCTG211280.18530144197989784No Hit
TGAGATGAAGCACTGTAGCTC210440.18456472666721746No Hit
CACCACGTTCCCGTGG206940.18149507953104912No Hit
TCTACAGTCCGACGATC205820.18051279244747528Illumina DpnII expression Sequencing Primer (100% over 17bp)
TCGTACCGTGAGTAATAATGC201310.17655733285201267No Hit
TAACGGAACCCATAATGCAGCT197960.17361924202168014No Hit
ACAGTCCGACGATC196940.17272465914199678Illumina DpnII expression Sequencing Primer (100% over 14bp)
TACCCTGTAGATCCGGATTTGT195950.17185638752348062No Hit
TTCACAGTGGTTAAGTTCTG184720.16200720542657482No Hit
TACCCTGTAGAACCGAATTTGCG182400.1599724678963147No Hit
AAGCTGCCAGCTGAAGAACT182380.1599549270555366No Hit
TTCACAGTGGTTAAGTTCTGCC177950.1560696308231864No Hit
TCGTACCGTGAGTAATAATGCA173780.15241236552095155No Hit
GGACAACTCTTAGCGG172630.15140376717621057No Hit
TATTGCACTTGTCCCGGCCTGTT169030.1482464158361517No Hit
AACATTCAACGCTGTCGGTGA168410.14770264977203046No Hit
TGAGGTAGTAGGTTGTATAGTTT160990.14119499784335363No Hit
TACAGTCCGACGATC157850.1384410858411912Illumina DpnII expression Sequencing Primer (100% over 15bp)
AACTCCAGTCACGGCTCCATCTCGTATGC157590.13821305491107583Illumina PCR Primer Index 11 (96% over 29bp)
AATGACACGTTTTCTCCCGGAT155960.1367834763876603No Hit
TAGCACCATTTGAAATCAGTGC155580.1364502004128763No Hit
TGGACAACTCTTAGCGG155000.13594151603031127No Hit
TGTAAACATCCTTGACTGGAAGC152560.1338015334553825No Hit
GTCTTTGCTGCGAGCC152090.13338932369709705No Hit
CAGAGTTCTACAGTCCGACGATC151800.13313498150581451Illumina DpnII expression Sequencing Primer (100% over 23bp)
TAACACTGTCTGGTAACGATGT151220.1326262971232495No Hit
TAGTTCTACAGTCCGACGATC148870.13056524833182218Illumina DpnII expression Sequencing Primer (95% over 21bp)
AACTCCAGTCACGGCTACATCT148260.13003025268809Illumina PCR Primer Index 11 (100% over 22bp)
TTCTACAGTCCGACGATC147130.1290391951841271Illumina DpnII expression Sequencing Primer (100% over 18bp)
TGAGGTAGTAGATTGAATAGTT146730.128688378368565No Hit
TGAGGTAGTAGGTTGTATAGT146050.12809198978210942No Hit
AACTCCAGTCACGGCTACATCTCGTATG145050.1272149477432042Illumina PCR Primer Index 11 (100% over 28bp)
CATTGCACTTGTCTCGGTCTGA141770.12433824985559504No Hit
TGAGAACTGAATTCCATAGA140220.12297883469529192No Hit
AAGCTGCCAGCTGAAGAACTGC140160.12292621217295759No Hit
TTCCAGTGATGACAGCCTATAATCTGACT136830.12000566218340317No Hit
TAGCACCATTTGAAATCGGTTA135920.11920755392799941No Hit
GCGTTGGTGGTATAGTGGTTAGCATAGC134860.11827788936675987No Hit
AACTCCAGTCACGGTTACATCTCGTATGC133740.117295602283186Illumina PCR Primer Index 11 (96% over 29bp)
TCCAGTGATGACAGCCTATAATCTGACT132580.11627823351805593No Hit
AGAGTTCTACAGTCCGACGATC129830.11386636791106654Illumina DpnII expression Sequencing Primer (100% over 22bp)
GTTCTACAGTCCGACG128450.1126560498973773Illumina DpnII expression Sequencing Primer (100% over 16bp)
CTACGCCTGTCTGAGGGTCGCT128190.11242801896726194No Hit
TTCAAGTAATCCAGGATAGG127280.11162991071185818No Hit
GTAACGGAACCCATAATGCAGCT124890.10953378023887468No Hit
TATTGCACTTGTCCCGGCCTGTA122870.1077621553202861No Hit
TTCACAGTGGTTAAGTTCTGC122090.10707806252994002No Hit
TGTCTGAGGGTCGCT120880.1060168416628647No Hit
TGTAAACATCCCCGACTGGAAGC120300.10550815728029965No Hit
TGTAAACATCCCCGACTGGAAGCT115670.10144745264016843No Hit
ACAGTAGTCTGCACATTGGTT115560.10135097801588884No Hit
TAGCTTATCAGACTGGTGTTGGCT115550.10134220759549979No Hit
TCGTACCGTGAGTAATAATG114640.10054409934009603No Hit
TGGCTCAGTTCAGCAGGAACAGT114470.10039500219348213No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATATGC501.3278623E-1038.07157523
CGTACGC1150.038.07157523
TCGATTG200.001601483238.0715723
CGTATGC5664200.037.49050523
CGTAGGC4150.037.15418623
TCATATG501.72804E-1037.15176822
AGTATGC1700.036.9518223
CGTGTGC1200.036.48525623
TCGTATG5709150.036.4216322
TAGTATG1750.036.09028622
CGTAAGC950.036.06780623
CTCATAT551.6370905E-1135.97959521
CGCGTAT453.448804E-935.9795921
TAACTGC850.035.8320723
TCGTAGG4000.035.75857522
TCTTCGT2200.035.5611220
CGATAAA3000.035.5611220
TGTCGTA1600.035.56111520
TCGCGTA601.8189894E-1235.56111520
CTCGTAT5803150.035.356821