FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_20_JM79_3_CTTGTA_L005_R1_001_TRIMMED_prinseq_good_aJyS.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_20_JM79_3_CTTGTA_L005_R1_001_TRIMMED_prinseq_good_aJyS.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8080584
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACCTTGTAATCTCGTATGC371902346.024185875674334Illumina PCR Primer Index 12 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTG2010452.4880008672640495No Hit
TTCAAGTAATCCAGGATAGGCT1820902.2534262375095664No Hit
ATGACCTATGAATTGACAGCCA1528091.8910638141995677No Hit
ATGACCTATGAATTGACAGCC1433901.7745004568976697No Hit
AACTCCAGTCACCTTGTAATCTCGTAT1138891.4094154580906528Illumina PCR Primer Index 12 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTT1113581.3780934645317715No Hit
AAGCTGCCAGCTGAAGAACTGT865521.0711107018997637No Hit
CCTGTCTGAGGGTCGCT794310.9829858831985412No Hit
TGGAGTGTGACAATGGTGTTT748370.9261335566835269No Hit
TAGCTTATCAGACTGGTGTTGGC710090.8787607430354043No Hit
TGGAGTGTGACAATGGTGTTTGT651550.8063154841283748No Hit
TATTGCACTTGTCCCGGCCTGT639780.7917497052193258No Hit
TCAGTAACTGGAATCTGTCCCT638800.7905369215888356No Hit
TTCAAGTAATCCAGGATAGGTT497530.6157104486507411No Hit
ACCACGTTCCCGTGG491120.6077778536798826No Hit
AACATTCAACGCTGTCGGTGAG416160.5150122812905602No Hit
AACATTCAACGCTGTCGGTGAGT385810.4774531147748727No Hit
GTTCTACAGTCCGAC372700.46122903988127584Illumina DpnII expression Adapter 1 (100% over 15bp)
TGTAAACATCCTTGACTGGAAGCT360820.44652713219737583No Hit
TGTAAACATCCTACACTCTCAGCT316630.3918404907368081No Hit
TAACGGAACCCATAATGCAGCTG289930.3587983244775378No Hit
TGAGGTAGTAGTTTGTATAGTT289020.35767216824922554No Hit
TGAGATGAAGCACTGTAGCTCT261020.3230212073780806No Hit
GGACAACTCTTAGCGG251520.3112646313682278No Hit
CTACAGTCCGACGATC248750.30783666131061815Illumina DpnII expression Sequencing Primer (100% over 16bp)
CACCACGTTCCCGTGG247660.30648774890527714No Hit
TGGACAACTCTTAGCGG238130.2946940468659196No Hit
TGAGATGAAGCACTGTAGCTC230840.2856724216962536No Hit
TAGCTTATCAGACTGGTGTTGG220230.27254218259472335No Hit
TCAGTAACTGGAATCTGTCCCTG216000.2673074124345468No Hit
TGAGAACTGAATTCCATAGATGG208840.2584466667260683No Hit
AGTTCTACAGTCCGACGATC198850.24608369890097054No Hit
TCTACAGTCCGACGATC182790.22620889777273523Illumina DpnII expression Sequencing Primer (100% over 17bp)
AACTCCAGTCACCTTGGAATCTCGTATGC180280.22310268663750044Illumina PCR Primer Index 12 (96% over 29bp)
CATTATTACTTTTGGTACGCG176930.21895694667613133No Hit
CTGTCTGAGGGTCGCT164530.2036115211474814No Hit
CTACGCCTGTCTGAGGGTCGCT163860.2027823731552076No Hit
TGTAAACATCCTACACTCAGCT160800.19899551814571817No Hit
TGTCTGAGGGTCGCT160210.19826537289879048No Hit
TTCCAGTGATGACAGCCTATAATCTGACT151180.18709043801784622No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT150790.18660779963428387No Hit
ACAGTAGTCTGCACATTGGTT149800.18538264066062551No Hit
TAACACTGTCTGGTAACGATGT148680.1839966022257797No Hit
TGTAACAGCAACTCCATGTGGA148580.18387284879409707No Hit
ACAGTCCGACGATC147630.18269719119311179Illumina DpnII expression Sequencing Primer (100% over 14bp)
TGGAGTGTGACAATGGTGTTTGA147570.18262293913410219No Hit
TAGTTCTACAGTCCGACGATC147320.18231355555489553Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGAGGTAGTAGGTTGTATAGTTT146020.18070476094302093No Hit
TGAGGTAGTAGGTTGTATAGT143670.17779655529847843No Hit
TGAGGTAGTAGATTGAATAGTT140130.17341568381691225No Hit
ATGACCTATGAATTGACAGCCAT137700.1704084754270236No Hit
TTCTACAGTCCGACGATC133830.16561921762090462Illumina DpnII expression Sequencing Primer (100% over 18bp)
CAGAGTTCTACAGTCCGACGATC133550.16527270801219318Illumina DpnII expression Sequencing Primer (100% over 23bp)
TCCAGTGATGACAGCCTATAATCTGACT131770.16306989692824184No Hit
TATTGCACTTGTCCCGGCCTGTT129720.16053295157874728No Hit
TTCACAGTGGCTAAGTTCTG127710.15804550760192582No Hit
TGAGAACTGAATTCCATAGATG127480.15776087470905567No Hit
TACAGTCCGACGATC125620.1554590608797582Illumina DpnII expression Sequencing Primer (100% over 15bp)
AACTCCAGTCACCTTGTAATCTCGTATG125340.15511255127104673Illumina PCR Primer Index 12 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTC123050.15227859768551383No Hit
TTCACAGTGGTTAAGTTCTG120750.14943226875681262No Hit
CATTGCACTTGTCTCGGTCTGA120470.14908575914810118No Hit
AACTCCAGTCACCTTGTATCTCGTATGCC119800.14825661115582736No Hit
AACTCCAGTCACCTTGTAACTCGTATGCC119280.14761309331107753No Hit
TTCAAGTAATCCAGGATAGG117750.1457196658063328No Hit
GTTCTACAGTCCGACG117650.14559591237465014Illumina DpnII expression Sequencing Primer (100% over 16bp)
AACTCCAGTCACCTTGTAATCTCGTA113530.14049727098932452Illumina PCR Primer Index 12 (100% over 26bp)
AGAGTTCTACAGTCCGACGATC112000.13860384348457983Illumina DpnII expression Sequencing Primer (100% over 22bp)
TAGCAGCACGTAAATATTGGAG108360.13409921857133097No Hit
CTGGACAACTCTTAGCGG106890.13228004312559588No Hit
TAACACTGTCTGGTAACGATG104990.1299287279236253No Hit
AACTCCAGTCACCTTGTAATCT104980.12991635258045706Illumina PCR Primer Index 12 (100% over 22bp)
AACTCCAGTCAACTTGTAATCTCGTATGC101930.12614187291413592Illumina PCR Primer Index 12 (96% over 29bp)
TTCACAGTGGCTAAGTTCTGC100280.12409994129137202No Hit
TGTAAACATCCCCGACTGGAAGCT100200.12400093854602588No Hit
TCACAGTGAACCGGTCTCTTT98290.12163724800088706No Hit
TCGTACCGTGAGTAATAATGCA96840.1198428232414885No Hit
TGTAAACATCCCCGACTGGAAGC96340.11922405608307518No Hit
AACATTCAACGCTGTCGGTGA96160.1190012999060464No Hit
TTCAAGTAATCCAGGATAGGC94230.11661285867457104No Hit
TCAGTAACTGGAATCTGTCCCTGC93480.11568470793695108No Hit
TGTAAACATCCTTGACTGGAAGC91880.11370465303002852No Hit
TCGTACCGTGAGTAATAATGC90540.11204635704548088No Hit
TTCAAGTAATCCAGGATAGGT90050.11143996523023583No Hit
TTCAAGTAATCCAGGATAGGCTT88250.10921240345994794No Hit
TGAGATGAAGCACTGTAGCT86870.10750460610272723No Hit
TATTGCACTTGTCCCGGCCTGTA86690.10728184992569845No Hit
TGAGGTAGTAGTTTGTGCTGTT86460.10699721703282832No Hit
TTCACAGTGGTTAAGTTCTGCC86010.10644032659025635No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACCCG700.038.48983823
CGTATGC3919650.037.56138223
ACAACCC4800.036.73158322
AGTATGC1000.036.56534623
TCGTATG3952350.036.47095522
TAACTGC800.036.0842223
CTTCGTA1300.036.0123221
CTAGTAT1050.036.0123221
TAGTATG1000.035.63744722
TCTCGTT405.4596967E-835.54720320
TCTCATA200.002242819635.54720320
CGATAAA1400.035.547220
TCGCGTA453.8817234E-935.547220
ATAACTA2450.035.2163822
GGTCCGG251.6647091E-435.16463519
ATGTCGT301.1788145E-535.16463519
TCAGCAT301.1788145E-535.16463519
ATCGCAT200.002365135.16463519
CTCGTAT4051100.035.16292621
GATTCCT19150.035.07298323