FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_20_JM84_3_AGTTCC_L006_R1_001_TRIMMED_prinseq_good_O68Z.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_20_JM84_3_AGTTCC_L006_R1_001_TRIMMED_prinseq_good_O68Z.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11148527
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACAGTTCCATCTCGTATGC562253950.43302133097942TruSeq Adapter, Index 14 (96% over 29bp)
ATGACCTATGAATTGACAGCC3870733.4719653995545783No Hit
ATGACCTATGAATTGACAGCCA3336142.992449137002583No Hit
TTCAAGTAATCCAGGATAGGCT2008681.801744750674237No Hit
TGGAGTGTGACAATGGTGTTTG1754791.5740106293862859No Hit
AAGCTGCCAGCTGAAGAACTGT1426911.2799089960494332No Hit
TGAGGTAGTAGGTTGTATAGTT1119581.0042402911164856No Hit
TAGCTTATCAGACTGGTGTTGGC1084840.9730792238293006No Hit
TGAGATGAAGCACTGTAGCTCT863340.7743982680402532No Hit
TGAGATGAAGCACTGTAGCTC794610.7127488680791643No Hit
TATTGCACTTGTCCCGGCCTGT743840.667209219657449No Hit
TGGAGTGTGACAATGGTGTTTGT711970.63862248349042No Hit
TGGAGTGTGACAATGGTGTTT710870.6376358060576074No Hit
ACCACGTTCCCGTGG704340.6317785300246391No Hit
CCTGTCTGAGGGTCGCT693960.6224678829768273No Hit
TGTAACAGCAACTCCATGTGGA643700.5773856940921432No Hit
GTTCTACAGTCCGAC586400.5259887696374598Illumina DpnII expression Adapter 1 (100% over 15bp)
AACATTCAACGCTGTCGGTGAGT557750.5002903074101179No Hit
AACATTCAACGCTGTCGGTGAG550010.493347686201056No Hit
AACTCCAGTCACAGTTCCATCTCGTAT544260.4881900541659001TruSeq Adapter, Index 14 (96% over 27bp)
TTCAAGTAATCCAGGATAGGTT449250.40296803335543796No Hit
TAACGGAACCCATAATGCAGCTG430780.3864008222790329No Hit
TGTAAACATCCTACACTCTCAGCT406540.3646580395777846No Hit
CTACAGTCCGACGATC367670.329792447020131Illumina DpnII expression Sequencing Primer (100% over 16bp)
TCAGTAACTGGAATCTGTCCCT366690.32891340712544354No Hit
CACCACGTTCCCGTGG361920.32463481498497515No Hit
TGAGAACTGAATTCCATAGATGG312260.28009081379091605No Hit
TGAGGTAGTAGTTTGTATAGTT309210.2773550263635725No Hit
TGTAAACATCCTTGACTGGAAGCT277990.24935132686138717No Hit
AGTTCTACAGTCCGACGATC271980.2439604801602938No Hit
TAGCTTATCAGACTGGTGTTGG251910.22595810190888893No Hit
ACAGTCCGACGATC241580.21669230383529592Illumina DpnII expression Sequencing Primer (100% over 14bp)
TCTACAGTCCGACGATC240320.2155621096849835Illumina DpnII expression Sequencing Primer (100% over 17bp)
GGACAACTCTTAGCGG232550.20859257909139028No Hit
TAACACTGTCTGGTAACGATGT229040.20544418110123425No Hit
TGAGATGAAGCACTGTAGCT220640.19790955343248484No Hit
AACTCCAGTCACAGTTCAATCTCGTATGC206040.18481365296061086RNA PCR Primer, Index 14 (96% over 29bp)
TGGACAACTCTTAGCGG204060.18303763358154848No Hit
TACAGTCCGACGATC203050.1821316843023298Illumina DpnII expression Sequencing Primer (100% over 15bp)
TAGCAGCACGTAAATATTGGAG195610.1754581569385803No Hit
AACTCCAGTGACAGTTCCATCTCGTATGC194570.17452529827483038RNA PCR Primer, Index 14 (96% over 29bp)
AACTCCAGTCACGGTTCCATCTCGTATGC190390.1707759240301432RNA PCR Primer, Index 14 (96% over 29bp)
TTCTACAGTCCGACGATC184900.1658515066609248Illumina DpnII expression Sequencing Primer (100% over 18bp)
GTTCTACAGTCCGACG181000.16235328667186258Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGTAACAGCAACTCCATGTGGAA170560.1529888208549883No Hit
CAGAGTTCTACAGTCCGACGATC167760.15047727829873847Illumina DpnII expression Sequencing Primer (100% over 23bp)
AACTCCAGTCACAGTTCCATCT167370.15012745629983226TruSeq Adapter, Index 14 (95% over 22bp)
ATGACCTATGAATTGACAGCCT167030.14982248327514477No Hit
TCAGTAACTGGAATCTGTCCCTG166560.14940090291748856No Hit
AACTCCAGTCACAGTTCCATCTCGTATG165650.14858465158670736TruSeq Adapter, Index 14 (96% over 28bp)
CATTGCACTTGTCTCGGTCTGA163290.14646778000358254No Hit
ATGACCTATGAATTGACAGC162940.1461538371840513No Hit
TGTCTGAGGGTCGCT162220.14550801195530136No Hit
TAGTTCTACAGTCCGACGATC161830.14515818995639512Illumina DpnII expression Sequencing Primer (95% over 21bp)
AGAGTTCTACAGTCCGACGATC161080.14448545534311394Illumina DpnII expression Sequencing Primer (100% over 22bp)
ACAGTAGTCTGCACATTGGTT157400.14118457084061417No Hit
CTGTCTGAGGGTCGCT156490.140368319509833No Hit
TTCCAGTGATGACAGCCTATAATCTGACT156380.14026965176655176No Hit
CATTATTACTTTTGGTACGCG155050.13907666905233312No Hit
TGAGGTAGTAGATTGAATAGTT154860.13890624295030185No Hit
TGAGGTAGTAGGTTGTATAGTTT153840.13799132387623944No Hit
TGAGGTAGTAGGTTGTATAGT151480.1358744522931146No Hit
TGTAAACATCCTACACTCAGCT149190.133820369273896No Hit
TATTGCACTTGTCCCGGCCTGTT147760.13253768861123985No Hit
ATGACCTATGAATTGACAGCCAT147540.13234035312467737No Hit
TCCAGTGATGACAGCCTATAATCTGACT140530.1260525269392091No Hit
TAACACTGTCTGGTAACGATG139180.12484160463530294No Hit
AACTCCAGTCACAGTTCCATCTC137940.12372935007467802TruSeq Adapter, Index 14 (95% over 23bp)
TTCACAGTGGCTAAGTTCTG136970.12285927997483434No Hit
AAATCCAGTCACAGTTCCATCTCGTATGC135660.12168423685030318RNA PCR Primer, Index 14 (96% over 29bp)
AACATTCAACGCTGTCGGTGA135400.1214510221843657No Hit
TCGTACCGTGAGTAATAATGCA133520.11976470075374082No Hit
TTCACAGTGGTTAAGTTCTG132060.11845511070655343No Hit
TGTAAACATCCCCGACTGGAAGCT127410.11428415610421No Hit
TTCACAGTGGCTAAGTTCTGC125230.11232874082827266No Hit
CTACGCCTGTCTGAGGGTCGCT121840.10928798037624164No Hit
TGAGAACTGAATTCCATAGATG121210.10872288330108543No Hit
CTGGACAACTCTTAGCGG112740.10112546706842976No Hit
CCACGTTCCCGTGG112500.10091019199217977No Hit
TTCAAGTAATCCAGGATAGG111690.10018363860983609No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATTCCG200.002094208736.04754323
CGTAAGC800.036.04754323
CGTATGC5889200.035.70017623
CGTAGGC3950.035.59124423
ATCACTA251.5966677E-435.41541322
TCGTAAG800.035.41541322
TCGTATG5932950.034.9333922
CTAGTAT700.034.74878321
CTCGTAA850.034.7487821
CGTGTGC1300.034.661123
TCGTAGG3900.034.50732422
TCTCCTA359.81554E-734.46839520
CTCGTAT5975800.034.33970321
ATAACTA4650.034.2729822
TACCGCC251.9659556E-434.18361319
TCTCGTA5980650.034.11078320
ATCTCGT5981900.033.84731319
GACAACC9450.033.82950221
AGACAAC10150.033.78921520
ACAACCC6400.033.75531422