FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_20_JM85_3_ATGTCA_L008_R1_001_TRIMMED_prinseq_good_lY4m.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_20_JM85_3_ATGTCA_L008_R1_001_TRIMMED_prinseq_good_lY4m.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16845900
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACATGTCAATCTCGTATGC512030830.39498038098291TruSeq Adapter, Index 15 (96% over 29bp)
ATGACCTATGAATTGACAGCC8577655.091832434004713No Hit
ATGACCTATGAATTGACAGCCA7789934.624229040894223No Hit
TAGCTTATCAGACTGGTGTTGGC4544222.697522839385251No Hit
TTCAAGTAATCCAGGATAGGCT3899162.3146047406193793No Hit
TGAGGTAGTAGGTTGTATAGTT3492732.0733412877910946No Hit
TATTGCACTTGTCCCGGCCTGT2794371.6587834428555315No Hit
AAGCTGCCAGCTGAAGAACTGT2602801.5450643776824033No Hit
AACATTCAACGCTGTCGGTGAGT2107241.2508919084168848No Hit
AACATTCAACGCTGTCGGTGAG2027051.203289821262147No Hit
CCTGTCTGAGGGTCGCT1993081.1831246772211637No Hit
AACTCCAGTCACATGTCAATCTCGTAT1608190.9546477184359399TruSeq Adapter, Index 15 (96% over 27bp)
ACCACGTTCCCGTGG1410550.8373254026202221No Hit
TGAGATGAAGCACTGTAGCTCT1243430.7381202547800949No Hit
TAACGGAACCCATAATGCAGCTG1222820.7258858238503137No Hit
TAACACTGTCTGGTAACGATGT1197460.7108317157290498No Hit
TGTAACAGCAACTCCATGTGGA1120950.6654141363773975No Hit
TGTAAACATCCTTGACTGGAAGCT1120500.6651470090645202No Hit
TGTAAACATCCTACACTCTCAGCT1108230.6578633376667319No Hit
TGAGATGAAGCACTGTAGCTC1105550.6562724461144849No Hit
TTCAAGTAATCCAGGATAGGTT1043090.6191951750871132No Hit
TGGAGTGTGACAATGGTGTTTG1029640.6112110365133356No Hit
TACCCTGTAGATCCGGATTTGT813550.4829365008696478No Hit
TAGCTTATCAGACTGGTGTTGG805070.4779026350625375No Hit
TGAGAACTGAATTCCATAGATGG791420.4697997732385922No Hit
GTTCTACAGTCCGAC758300.4501392030108216Illumina DpnII expression Adapter 1 (100% over 15bp)
TAACACTGTCTGGTAACGATG678030.4024896265560166No Hit
CACCACGTTCCCGTGG605110.35920312954487443No Hit
CTACAGTCCGACGATC594440.3528692441484278Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGGTAGTAGTTTGTATAGTT572730.33998183534272436No Hit
TACCCTGTAGATCCGGATTTGTG571540.33927543200422655No Hit
TATTGCACTTGTCCCGGCCTGTT558960.33180773956867843No Hit
TAGCAGCACGTAAATATTGGAG537850.31927650051347806No Hit
TGGAGTGTGACAATGGTGTTT470760.27945078624472425No Hit
CATTGCACTTGTCTCGGTCTGA459630.2728438373728919No Hit
GGACAACTCTTAGCGG457410.2715260092960305No Hit
TGAGGTAGTAGATTGAATAGTT451970.26829673689146916No Hit
AACATTCAACGCTGTCGGTGA450660.26751909960287074No Hit
CTGTCTGAGGGTCGCT444070.2636071685098451No Hit
TGTCTGAGGGTCGCT441670.26218248950783274No Hit
CCACGTTCCCGTGG437410.25965368427926083No Hit
CATTATTACTTTTGGTACGCG434690.2580390480769802No Hit
AGTTCTACAGTCCGACGATC427170.25357505387067475No Hit
CTACGCCTGTCTGAGGGTCGCT419430.24898046408918492No Hit
TCTACAGTCCGACGATC415710.24677221163606575Illumina DpnII expression Sequencing Primer (100% over 17bp)
TGGAGTGTGACAATGGTGTTTGT401650.2384259671492767No Hit
ACAGTCCGACGATC399500.23714969220997392Illumina DpnII expression Sequencing Primer (100% over 14bp)
TGGACAACTCTTAGCGG390690.2319199330400869No Hit
TCAGTAACTGGAATCTGTCCCT376160.22329468891540372No Hit
ATGACCTATGAATTGACAGCCAT373760.2218700099133914No Hit
TACCCTGTAGAACCGAATTTGT373600.22177503131325724No Hit
TGAGGTAGTAGGTTGTATAGTTT360260.2138561905270719No Hit
ATGACCTATGAATTGACAGCCT349010.20717800770513892No Hit
TGAGGTAGTAGGTTGTATAGT347700.20640037041654052No Hit
AACTCCAGTCACATGTCAATCT338060.20067790975845756TruSeq Adapter, Index 15 (95% over 22bp)
TGAGGTAGTAGGTTGTGTGGTT336930.20000712339501006No Hit
TGTAACAGCAACTCCATGTGGAA330320.19608331997696768No Hit
TTCTACAGTCCGACGATC322720.19157183647059522Illumina DpnII expression Sequencing Primer (100% over 18bp)
TACAGTCCGACGATC322690.19155402798307006Illumina DpnII expression Sequencing Primer (100% over 15bp)
TGTAAACATCCTACACTCAGCT316870.1880991814031901No Hit
TGAGAACTGAATTCCATAGATG314590.18674573635127836No Hit
TGAGATGAAGCACTGTAGCT307590.18259042259540897No Hit
ATGACCTATGAATTGACAGC304570.18079770151787677No Hit
TAACACTGTCTGGTAACGATGTT301710.17909995904047868No Hit
TTCACAGTGGTTAAGTTCTG291440.17300352014436746No Hit
TGTAAACATCCTTGACTGGAAGC287740.1708071400162651No Hit
TATTGCACTTGTCCCGGCCTGTA285880.1697030137897055No Hit
TCACAGTGAACCGGTCTCTTT279400.16585638048427215No Hit
TAGTTCTACAGTCCGACGATC278160.1651202963332324Illumina DpnII expression Sequencing Primer (95% over 21bp)
TTCACAGTGGCTAAGTTCTG269440.15994396262592087No Hit
TATTGCACTTGTCCCGGCCTGTTT264850.1572192640345722No Hit
AACTCCAGTCACATGGCAATCTCGTATGC257200.15267809971565782RNA PCR Primer, Index 15 (96% over 29bp)
TTCCAGTGATGACAGCCTATAATCTGACT254640.1511584421135113No Hit
TCGTACCGTGAGTAATAATGCA254540.15109908048842746No Hit
ACAGTAGTCTGCACATTGGTT252950.15015523064959427No Hit
TTCAAGTAATCCAGGATAGG246030.14604740619379197No Hit
GTTCTACAGTCCGACG244860.14535287518031093Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGTAAACATCCCCGACTGGAAGCT242700.1440706640784998No Hit
CAGAGTTCTACAGTCCGACGATC241300.14323960132732594Illumina DpnII expression Sequencing Primer (100% over 23bp)
AACTCCAGTCACATGTCAATCTC237170.140787966211363TruSeq Adapter, Index 15 (95% over 23bp)
TGTAAACATCCTACACTCTCAGC228940.13590250446696228No Hit
AACTCCAGTCACATGTCAATCTCGTATG225100.1336230180637425TruSeq Adapter, Index 15 (96% over 28bp)
CTGGACAACTCTTAGCGG223900.13291067856273633No Hit
TGTAAACATCCCCGACTGGAAGC223050.13240610474952363No Hit
TATTGCACTTGTCCCGGCCTGTAT222570.13212116894912115No Hit
TTCACAGTGGCTAAGTTCTGC221220.1313197870104892No Hit
TAATACTGTCTGGTAATGCCG215090.12768091939284928No Hit
AGAGTTCTACAGTCCGACGATC213470.12671926106649095Illumina DpnII expression Sequencing Primer (100% over 22bp)
TCCAGTGATGACAGCCTATAATCTGACT212030.12586445366528354No Hit
TTCACAGTGGTTAAGTTCTGCC206270.12244522406045387No Hit
TTCAAGTAATCCAGGATAGGC198520.11784469811645563No Hit
TCGTACCGTGAGTAATAATGC197300.11712048629043269No Hit
AAGCTGCCAGCTGAAGAACT196780.11681180583999669No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT194240.11530402056286694No Hit
TTCAAGTAATCCAGGATAGGCTT193810.11504876557500637No Hit
TGAGGTAGTAGTTTGTGCTGTT178350.10587145833704344No Hit
AAGCTGCCAGCTGAAGAACTGC175120.10395407784683515No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTATGCG150.005972642554.5574823
TATACCG150.005972642554.5574823
TAACTAA900.054.5574823
CATATGC251.2463419E-554.55747623
TATGCCC251.2463419E-554.55747623
CGTGTGC1450.054.55747623
TAACTAC251.2463419E-554.55747623
CGTATGC5366850.053.83469823
TCGTACG306.983646E-753.0348722
GGCATAA150.006680221853.0348722
TCATACC150.006680221853.0348722
GCGTATG401.5934347E-953.0348722
AGTATGC1400.052.60899723
TCGTATG5414050.052.1679422
ATAACTA5150.052.00506222
ACAACCC7700.050.96857522
CCCGTAT150.00797366450.7131421
AGGCATA150.00797366450.7131421
CTCGTAA402.3701432E-950.71313521
CTAGTAT1450.050.71313521