FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_27_JM61_3_CCGTCC_L004_R1_001_TRIMMED_prinseq_good_2n4U.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_27_JM61_3_CCGTCC_L004_R1_001_TRIMMED_prinseq_good_2n4U.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13319258
Sequences flagged as poor quality0
Sequence length12-29
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACCCGTCCATCTCGTATGC453838334.0738425518899TruSeq Adapter, Index 16 (96% over 29bp)
ATGACCTATGAATTGACAGCC5283973.9671654381948307No Hit
ATGACCTATGAATTGACAGCCA5162283.8758014898427526No Hit
TAGCTTATCAGACTGGTGTTGGC4817773.617145940111679No Hit
TAACGGAACCCATAATGCAGCTG3350982.5158909002288268No Hit
TTCAAGTAATCCAGGATAGGCT2835702.129022502604875No Hit
TGAGAACTGAATTCCATAGATGG1885551.4156569382468602No Hit
TGAGGTAGTAGGTTGTATAGTT1756111.3184743474448801No Hit
TGGAGTGTGACAATGGTGTTTG1251700.9397670651022751No Hit
TAGCTTATCAGACTGGTGTTGG1108390.8321709812964055No Hit
TATTGCACTTGTCCCGGCCTGT1036870.7784742963909851No Hit
TGAGATGAAGCACTGTAGCTCT1008840.7574295805366935No Hit
AACATTCAACGCTGTCGGTGAGT1003280.7532551738242476No Hit
AACATTCAACGCTGTCGGTGAG902550.6776278378270021No Hit
AAGCTGCCAGCTGAAGAACTGT889910.668137819689355No Hit
CCTGTCTGAGGGTCGCT885860.6650971097639222No Hit
TGAGATGAAGCACTGTAGCTC758010.5691082791548898No Hit
TGAGAACTGAATTCCATAGATG730240.5482587693698854No Hit
TTCAAGTAATCCAGGATAGGTT694480.5214104269171751No Hit
TGTAACAGCAACTCCATGTGGA656070.49257248414288546No Hit
TGGAGTGTGACAATGGTGTTT597920.44891389595426406No Hit
TGGAGTGTGACAATGGTGTTTGT572250.42964105057503954No Hit
TAGCAGCACGTAAATATTGGAG522480.3922741041580544No Hit
TGTAAACATCCTTGACTGGAAGCT487530.3660339036904308No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC477120.3582181529932073No Hit
TGAGGTAGTAGTTTGTATAGTT476660.35787278840908404No Hit
TTCACAGTGGTTAAGTTCTG451560.3390278947971426No Hit
TGTAAACATCCTACACTCTCAGCT432600.3247928675906721No Hit
GTTCTACAGTCCGAC408540.30672879825587884Illumina DpnII expression Adapter 1 (100% over 15bp)
TCCCATATGGTCTAGCGGTTAGGATTCCT402850.30245678850878926No Hit
ACCACGTTCCCGTGG390030.29283162770778975No Hit
AATGACACGTTTTCTCCCGGATT362850.2724250855415519No Hit
TCAGTAACTGGAATCTGTCCCT358200.26893390007161055No Hit
CTACAGTCCGACGATC329380.24729605808371607Illumina DpnII expression Sequencing Primer (100% over 16bp)
ATGACCTATGAATTGACAGCCAT325270.24421030060383245No Hit
TTCACAGTGGTTAAGTTCTGCC319220.2396680055300378No Hit
TAACACTGTCTGGTAACGATGT318250.23893973673308225No Hit
TGAGATGAAGCACTGTAGCT297050.22302293416044647No Hit
CTACGCCTGTCTGAGGGTCGCT281600.21142318888935102No Hit
TTCACAGTGGCTAAGTTCTG274680.206227704276019No Hit
TGAGGTAGTAGGTTGTATAGTTT264970.1989375083807221No Hit
ATGACCTATGAATTGACAGCCT253690.19046856814396118No Hit
TGAGAACTGAATTCCATAGATGGT250260.18789334961452056No Hit
ATGACCTATGAATTGACAGC250210.18785580998581153No Hit
CATTATTACTTTTGGTACGCG246140.1848000842088951No Hit
TTCACAGTGGCTAAGTTCTGC244150.18330600698627506No Hit
AGTTCTACAGTCCGACGATC240240.1803704080212276No Hit
TGAGGTAGTAGGTTGTATAGT239930.18013766232323153No Hit
TGAGGTAGTAGATTGAATAGTT237870.1785910296204188No Hit
ACAGTCCGACGATC228380.17146600809144175Illumina DpnII expression Sequencing Primer (100% over 14bp)
TTCACAGTGGTTAAGTTCTGC227500.1708053106261625No Hit
TGTAAACATCCTACACTCAGCT223430.16774958484924613No Hit
CATTGCACTTGTCTCGGTCTGA223230.1675994263344099No Hit
AAATCCAGTCACCCGTCCATCTCGTATGC220580.16560982601283045RNA PCR Primer, Index 16 (96% over 29bp)
TATTGCACTTGTCCCGGCCTGTT220470.16552723882967055No Hit
TAACGGAACCCATAATGCAGCT216570.16259914779036488No Hit
GGACAACTCTTAGCGG214170.16079724561233064No Hit
TGGACAACTCTTAGCGG213910.1606020395430436No Hit
CTGTCTGAGGGTCGCT207810.1560222048405399No Hit
TGTAACAGCAACTCCATGTGGAA206550.15507620619707194No Hit
AATGACACGTTTTCTCCCGGATTG204320.15340193875664845No Hit
TGTCTGAGGGTCGCT204140.15326679609329588No Hit
TTCAAGTAATCCAGGATAGG198930.14935516678181324No Hit
CACCACGTTCCCGTGG196310.1473880902374592No Hit
TAACACTGTCTGGTAACGATG187810.14100635335692122No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG185320.1391368798472107No Hit
GTAACGGAACCCATAATGCAGCT184670.13864886467399312No Hit
TCTACAGTCCGACGATC181880.1365541533920283Illumina DpnII expression Sequencing Primer (100% over 17bp)
TACAGTCCGACGATC176540.1325449210459021Illumina DpnII expression Sequencing Primer (100% over 15bp)
ACAGTAGTCTGCACATTGGTT172450.12947417941750208No Hit
GCATTGTGGTTCAGTGGTAGAATTCTC170610.12809272108100916No Hit
AACATTCAACGCTGTCGGTGA169750.12744703946721356No Hit
TGAGAACTGAATTCCATAGAT169360.12715423036328302No Hit
AACAGTAAGAGTTTATGTGCTG168490.12650104082374558No Hit
GTCTTTGCTGCGAGCC163820.12299483950232062No Hit
TAGTTCTACAGTCCGACGATC161770.12145571472524971Illumina DpnII expression Sequencing Primer (95% over 21bp)
TTCTACAGTCCGACGATC158840.11925589248289957Illumina DpnII expression Sequencing Primer (100% over 18bp)
TCGTACCGTGAGTAATAATGC158430.1189480675274854No Hit
CATAAAGTAGAAAGCACTACT153610.11532924731993328No Hit
AACTCCAGTCACCCTTCCATCTCGTATGC152220.1142856456418218RNA PCR Primer, Index 16 (96% over 29bp)
TAGCTTATCAGACTGGTGTTGGCT149720.11240866420636945No Hit
TCGTACCGTGAGTAATAATGCA148900.11179301429554107No Hit
CAGAGTTCTACAGTCCGACGATC146540.11002114382047408Illumina DpnII expression Sequencing Primer (100% over 23bp)
TGAGGTAGTAGGTTGTGTGGTT146400.10991603286008875No Hit
TTCCAGTGATGACAGCCTATAATCTGACT146340.10987098530563791No Hit
AAGCTGCCAGCTGAAGAACT144270.10831684467708337No Hit
TTCACAGTGGTTAAGTTCTGCCT144160.10823425749392347No Hit
GTTCTACAGTCCGACG143520.10775375024644766Illumina DpnII expression Sequencing Primer (100% over 16bp)
TTCAAGTAATCCAGGATAGGC142750.10717563996432834No Hit
AATGACACGTTTTCTCCCGGAT142270.10681525952872149No Hit
GCGTTGGTGGTATAGTGGTTAGCATAGC139140.10446527877153518No Hit
TCACAGTGAACCGGTCTCTTT138310.10384212093496499No Hit
TGTAAACATCCTTGACTGGAAGC138030.10363189901419433No Hit
TTCCCTTTGTCATCCTATGCCT136890.10277599547962807No Hit
TGTAAACATCCCCGACTGGAAGC136130.10220539312325055No Hit
TCCAGTGATGACAGCCTATAATCTGACT135200.10150715602926229No Hit
TGTAAACATCCCCGACTGGAAGCT134750.10116929937088086No Hit
TGGCTCAGTTCAGCAGGAACAGT134590.10104917255901191No Hit
GTCCAGTTTTCCCAGGAATCCCT133930.1005536494600525No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATGCCC301.2401197E-648.79797423
CGTATGC4793150.048.0741223
CGTAGGC1950.047.5467423
ATAACTA4750.046.25618722
TCGTATG4803250.045.95944622
ATCGGGC750.045.54477323
ACAACCC8150.045.31427822
GATTCCT46650.045.03221523
CTCGTAT4784350.044.89611421
TCTCATA454.0745363E-1044.74662820
TCTCGTA4771500.044.22709720
CGATAAA5900.043.98821320
GTCGTAT1450.043.96457321
CATATGC504.8930815E-1043.9181823
CGTACGC504.8930815E-1043.9181823
GACAACC14400.043.79556321
ATCTCGT4768950.043.5321819
TATGGCG459.442374E-943.37597723
GGATTCC51900.043.23539722
TGTCGTA1450.043.2036420