FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_27_JM69_3_GTAGAG_L005_R1_001_TRIMMED_prinseq_good_eQzp.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_27_JM69_3_GTAGAG_L005_R1_001_TRIMMED_prinseq_good_eQzp.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7257793
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGTAGAGATCTCGTATGC387576153.40137146374938RNA PCR Primer, Index 17 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTG1491662.0552528847268032No Hit
TTCAAGTAATCCAGGATAGGCT1337791.8432462871288833No Hit
ATGACCTATGAATTGACAGCCA922981.2717089065505176No Hit
TGAGGTAGTAGGTTGTATAGTT895391.2336945955884935No Hit
TAGCTTATCAGACTGGTGTTGGC814041.1216081803380173No Hit
AAGCTGCCAGCTGAAGAACTGT790421.0890638517797353No Hit
ATGACCTATGAATTGACAGCC779091.073453045574598No Hit
TATTGCACTTGTCCCGGCCTGT702390.9677735366660362No Hit
TGGAGTGTGACAATGGTGTTT575280.7926376516938413No Hit
TGGAGTGTGACAATGGTGTTTGT574450.7914940533575427No Hit
GTTCTACAGTCCGAC418040.5759877692846848Illumina DpnII expression Adapter 1 (100% over 15bp)
TAACGGAACCCATAATGCAGCTG404860.5578279788359906No Hit
CCTGTCTGAGGGTCGCT379160.5224177652903575No Hit
AACATTCAACGCTGTCGGTGAGT355720.49012144600982693No Hit
ACCACGTTCCCGTGG352900.4862359673250532No Hit
TGTAAACATCCTTGACTGGAAGCT320690.44185608490074046No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT311900.42974496517054156No Hit
CTACAGTCCGACGATC307810.42410964324829875Illumina DpnII expression Sequencing Primer (100% over 16bp)
AACATTCAACGCTGTCGGTGAG300970.41468529069374116No Hit
TGTAAACATCCTACACTCTCAGCT296680.4087744029073301No Hit
TTCAAGTAATCCAGGATAGGTT295630.4073276821204463No Hit
AGTTCTACAGTCCGACGATC274400.37807636563897595No Hit
TCAGTAACTGGAATCTGTCCCT262600.3618179796530433No Hit
TCTACAGTCCGACGATC240680.3316159609401922Illumina DpnII expression Sequencing Primer (100% over 17bp)
TGAGGTAGTAGTTTGTATAGTT212450.29271983921282957No Hit
TAGTTCTACAGTCCGACGATC208090.28671250337395954Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGGACAACTCTTAGCGG204780.28215188832197335No Hit
CACCACGTTCCCGTGG198770.27387113410371444No Hit
ACAGTCCGACGATC196960.27137726303299087Illumina DpnII expression Sequencing Primer (100% over 14bp)
GGACAACTCTTAGCGG188210.2593212564756256No Hit
TAGCTTATCAGACTGGTGTTGG186230.25659315442035896No Hit
TTCTACAGTCCGACGATC171880.23682130366627982Illumina DpnII expression Sequencing Primer (100% over 18bp)
AACTCCAGTCACGTTGAGATCTCGTATGC169440.23345940012342595RNA PCR Primer, Index 17 (96% over 29bp)
CAGAGTTCTACAGTCCGACGATC169350.2333353954845502Illumina DpnII expression Sequencing Primer (100% over 23bp)
TACAGTCCGACGATC159320.21951576739650744Illumina DpnII expression Sequencing Primer (100% over 15bp)
TTCCAGTGATGACAGCCTATAATCTGACT149180.2055445780831721No Hit
AACTCCAGTCACGGAGAGATCTCGTATGC147270.20291292408036438RNA PCR Primer, Index 17 (96% over 29bp)
AGAGTTCTACAGTCCGACGATC144190.19866920977217178Illumina DpnII expression Sequencing Primer (100% over 22bp)
GTTCTACAGTCCGACG142680.19658868749770075Illumina DpnII expression Sequencing Primer (100% over 16bp)
TCCAGTGATGACAGCCTATAATCTGACT129650.17863557144713274No Hit
TATTGCACTTGTCCCGGCCTGTT129580.17853912339467384No Hit
TGTAACAGCAACTCCATGTGGA121850.16788850274456713No Hit
TGAGGTAGTAGGTTGTATAGT119340.16443015114925433No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC116740.16084779491506576No Hit
TGAGGTAGTAGGTTGTATAGTTT116510.1605308941712722No Hit
TAACACTGTCTGGTAACGATGT114340.15754100454504558No Hit
CATTGCACTTGTCTCGGTCTGA112140.15450978003919372No Hit
TCAGTAACTGGAATCTGTCCCTG110450.15218124848697118No Hit
TGAGATGAAGCACTGTAGCTC110410.1521261353141375No Hit
CTGGACAACTCTTAGCGG109470.15083097575254628No Hit
TGAGGTAGTAGATTGAATAGTT109050.15025228743779273No Hit
AACTCCAGTCAAGTAGAGATCTCGTATGC102010.14055236901906681RNA PCR Primer, Index 17 (96% over 29bp)
TGAGAACTGAATTCCATAGATGG100460.1384167335717621No Hit
CTACGCCTGTCTGAGGGTCGCT100140.13797582818909276No Hit
ACAGTAGTCTGCACATTGGTT98260.13538550906591026No Hit
ACTCCAGTCACGTAGAGATCTCGTATGCC96000.1322716148008079RNA PCR Primer, Index 17 (100% over 29bp)
TAGCAGCACGTAAATATTGGAG95010.13090756377317458No Hit
TGTAAACATCCTACACTCAGCT94130.12969507397083382No Hit
TTCAAGTAATCCAGGATAGG92050.126829188983483No Hit
AACATTCAACGCTGTCGGTGA91140.125575364301517No Hit
TGAGATGAAGCACTGTAGCTCT89770.12368773813196382No Hit
CATTATTACTTTTGGTACGCG88340.1217174422031601No Hit
CTGTCTGAGGGTCGCT87020.119898707499649No Hit
TGTAAACATCCCCGACTGGAAGCT86020.11852087817880726No Hit
GTCTTTGCTGCGAGCC83660.11526920098162072No Hit
TTCACAGTGGCTAAGTTCTG82990.11434605533665675No Hit
TGAGGTAGTAGGTTGTGTGGTT78240.10780136606265843No Hit
TCACAGTGAACCGGTCTCTTT74870.10315808125142174No Hit
TGGAGTGTGACAATGGTGTTTGA73470.10122912020224331No Hit
TGAGGTAGTAGTTTGTGCTGTT73010.1005953187146561No Hit
TGTCTGAGGGTCGCT72890.10042997919615508No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTGTGC200.002685100834.26637323
AGTATGC301.4073767E-534.2663723
CGTAGGC251.9381095E-434.2663723
CGTATGC4045350.033.88731423
TCGTAGG252.1779929E-433.5923922
GCGGAAT252.1779929E-433.5923922
CTAGTAT351.3109366E-633.21532421
TCGTATG4060850.033.09729422
ATAACTA2650.032.9585722
CGATAAA1750.032.91099520
CTCGTAT4057500.032.73193421
GGATTGC750.032.58167319
TCTCGTA4051000.032.46050620
GACAACC5850.032.3636521
GCGATAA10150.032.2606719
ATCTCGT4047600.032.1433719
AGACAAC6450.031.89049520
CGATAAC8400.031.73559820
GATAACA1050.031.63364421
ACAACCC3750.031.35289222